\
| Variant ID: vg0217968982 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 17968982 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 113. )
CGAAAATGATTTTCGTAGGTGCCGTTTAAGTGGACAGCGAACTTCACCCCGATTTATATTTTTGTAGGCGGTTATTTGGTTATAAGAATCATGTCCGCCT[G/A]
CGAAAAAAAGACCCTTACGTTGGGAAAAATGTGTTTTCTAGTAGTGTGGTTAGTTGTAGATAGTTGCGAAGACATAAAGATTTTTAAATCTGAACATAAC
GTTATGTTCAGATTTAAAAATCTTTATGTCTTCGCAACTATCTACAACTAACCACACTACTAGAAAACACATTTTTCCCAACGTAAGGGTCTTTTTTTCG[C/T]
AGGCGGACATGATTCTTATAACCAAATAACCGCCTACAAAAATATAAATCGGGGTGAAGTTCGCTGTCCACTTAAACGGCACCTACGAAAATCATTTTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 44.70% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 56.10% | 43.70% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 54.60% | 45.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 65.80% | 34.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.20% | 22.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 20.40% | 79.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 65.50% | 34.10% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 27.40% | 72.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 44.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0217968982 | G -> A | LOC_Os02g30210-LOC_Os02g30219 | intergenic_region ; MODIFIER | silent_mutation | Average:70.346; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0217968982 | NA | 2.02E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0217968982 | 1.03E-06 | 1.98E-08 | mr1138 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | 9.88E-06 | 3.22E-07 | mr1169 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 9.06E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | 4.72E-06 | 1.03E-06 | mr1354 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 1.15E-09 | mr1563 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 1.88E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 4.00E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 7.44E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 1.77E-08 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | 3.14E-07 | NA | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | 4.55E-06 | 5.37E-08 | mr1138_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 2.88E-07 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 1.08E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 2.08E-07 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 4.54E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 9.41E-08 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 2.47E-09 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | 2.96E-06 | NA | mr1855_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | 7.94E-06 | NA | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 2.14E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 6.69E-10 | mr1864_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0217968982 | NA | 8.02E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |