Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0212604991:

Variant ID: vg0212604991 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 12604991
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

TAATAATGATGGTGATTCTCCCTTCAAACACTGACATCCTTCTCAGGATCTTAGATCCAGCAACTGAGATTCATCCCATGATCCACCCCATCTCTCTTGA[G/T]
TGCCCCATGTCTCACCACCGTGAAAAGACATGCGTAAATCCTTGTGTTCCTCTTCTGCTCCCACAAAACAGCAGAGTGCTACCAGCTGCTCTCCCTTCCC

Reverse complement sequence

GGGAAGGGAGAGCAGCTGGTAGCACTCTGCTGTTTTGTGGGAGCAGAAGAGGAACACAAGGATTTACGCATGTCTTTTCACGGTGGTGAGACATGGGGCA[C/A]
TCAAGAGAGATGGGGTGGATCATGGGATGAATCTCAGTTGCTGGATCTAAGATCCTGAGAAGGATGTCAGTGTTTGAAGGGAGAATCACCATCATTATTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.40%	11.40%	1.14%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.04%	0.00%	NA
All Japonica	1512	61.60%	34.90%	3.51%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	29.70%	64.40%	5.87%	0.00%	NA
Tropical Japonica	504	98.00%	1.60%	0.40%	0.00%	NA
Japonica Intermediate	241	87.10%	10.40%	2.49%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0212604991	G -> T	LOC_Os02g21240.1	upstream_gene_variant ; 755.0bp to feature; MODIFIER	silent_mutation	Average:74.18; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N
vg0212604991	G -> T	LOC_Os02g21250.1	upstream_gene_variant ; 4032.0bp to feature; MODIFIER	silent_mutation	Average:74.18; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N
vg0212604991	G -> T	LOC_Os02g21250.2	upstream_gene_variant ; 4157.0bp to feature; MODIFIER	silent_mutation	Average:74.18; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N
vg0212604991	G -> T	LOC_Os02g21240-LOC_Os02g21250	intergenic_region ; MODIFIER	silent_mutation	Average:74.18; most accessible tissue: Zhenshan97 young leaf, score: 87.004	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0212604991	1.62E-06	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0212604991	1.45E-06	NA	Yield	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0212604991	NA	1.29E-06	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212604991	NA	5.69E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212604991	NA	7.62E-07	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0212604991	NA	1.47E-07	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251