| Variant ID: vg0210667883 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 10667883 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 291. )
ATGCATGCATGCTACCATGTTGACACATATTGAATATATCAGCTATAACTCTTTAATTTGTTTAAATTAATGGCATTTCTTATTGTTCTTCATTTTGTCG[C/T]
GGATAAGAGATTGATGTAGTATATATGCCATTTTATGGTGCGTGGTCAATATTAATTGGAGCCAGGAATAAGATCTTAACCAAGGCAGGTGATAGAGAAG
CTTCTCTATCACCTGCCTTGGTTAAGATCTTATTCCTGGCTCCAATTAATATTGACCACGCACCATAAAATGGCATATATACTACATCAATCTCTTATCC[G/A]
CGACAAAATGAAGAACAATAAGAAATGCCATTAATTTAAACAAATTAAAGAGTTATAGCTGATATATTCAATATGTGTCAACATGGTAGCATGCATGCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 8.00% | 3.91% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 1.60% | 1.59% | 0.00% | NA |
| All Japonica | 1512 | 69.90% | 21.60% | 8.53% | 0.00% | NA |
| Aus | 269 | 97.00% | 0.70% | 2.23% | 0.00% | NA |
| Indica I | 595 | 91.10% | 4.70% | 4.20% | 0.00% | NA |
| Indica II | 465 | 97.20% | 0.60% | 2.15% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 1.30% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 52.80% | 36.50% | 10.69% | 0.00% | NA |
| Tropical Japonica | 504 | 91.90% | 2.80% | 5.36% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 13.30% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 7.80% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0210667883 | C -> T | LOC_Os02g18340.1 | downstream_gene_variant ; 4812.0bp to feature; MODIFIER | silent_mutation | Average:46.031; most accessible tissue: Zhenshan97 young leaf, score: 60.8 | N | N | N | N |
| vg0210667883 | C -> T | LOC_Os02g18340-LOC_Os02g18350 | intergenic_region ; MODIFIER | silent_mutation | Average:46.031; most accessible tissue: Zhenshan97 young leaf, score: 60.8 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0210667883 | NA | 3.29E-14 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0210667883 | NA | 1.79E-12 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0210667883 | NA | 1.45E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210667883 | NA | 1.61E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210667883 | NA | 4.23E-12 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210667883 | NA | 2.73E-08 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210667883 | 5.81E-08 | NA | mr1549_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210667883 | NA | 5.03E-09 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0210667883 | NA | 2.35E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |