\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210594191:

Variant ID: vg0210594191 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10594191
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGGTGTTGAAGTAGATGGGATCTCATCCGAGTGGTTTGAACCCGACTCGATCGAGATAAGCTTGGGGTAGATCTCGGCCGAGTTCGGAATACCGAACG[A/G]
GGCTGGGACCTAGTCTCTCCCTAACTGGTTTGAATCCGAGTCAAGGAGAGAAATCTTGCCGAAGTCGTTGGTGATGAAGTCGAGGCTGCCGAACCGGAAT

Reverse complement sequence

ATTCCGGTTCGGCAGCCTCGACTTCATCACCAACGACTTCGGCAAGATTTCTCTCCTTGACTCGGATTCAAACCAGTTAGGGAGAGACTAGGTCCCAGCC[T/C]
CGTTCGGTATTCCGAACTCGGCCGAGATCTACCCCAAGCTTATCTCGATCGAGTCGGGTTCAAACCACTCGGATGAGATCCCATCTACTTCAACACCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 9.90% 19.28% 5.67% NA
All Indica  2759 60.70% 0.60% 29.25% 9.42% NA
All Japonica  1512 65.00% 29.10% 5.75% 0.13% NA
Aus  269 97.00% 0.70% 2.23% 0.00% NA
Indica I  595 70.80% 1.80% 14.79% 12.61% NA
Indica II  465 55.10% 0.40% 33.12% 11.40% NA
Indica III  913 56.60% 0.10% 38.88% 4.38% NA
Indica Intermediate  786 61.20% 0.40% 26.72% 11.70% NA
Temperate Japonica  767 42.20% 49.70% 8.08% 0.00% NA
Tropical Japonica  504 95.00% 2.40% 2.18% 0.40% NA
Japonica Intermediate  241 74.70% 19.50% 5.81% 0.00% NA
VI/Aromatic  96 96.90% 1.00% 2.08% 0.00% NA
Intermediate  90 73.30% 10.00% 10.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210594191 A -> G LOC_Os02g18240.1 upstream_gene_variant ; 4238.0bp to feature; MODIFIER silent_mutation Average:40.747; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 N N N N
vg0210594191 A -> G LOC_Os02g18250.1 downstream_gene_variant ; 2340.0bp to feature; MODIFIER silent_mutation Average:40.747; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 N N N N
vg0210594191 A -> G LOC_Os02g18270.1 downstream_gene_variant ; 1211.0bp to feature; MODIFIER silent_mutation Average:40.747; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 N N N N
vg0210594191 A -> G LOC_Os02g18260.1 intron_variant ; MODIFIER silent_mutation Average:40.747; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 N N N N
vg0210594191 A -> DEL N N silent_mutation Average:40.747; most accessible tissue: Zhenshan97 flag leaf, score: 86.342 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0210594191 A G 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210594191 NA 5.93E-20 Heading_date All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210594191 NA 2.12E-19 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210594191 NA 1.78E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210594191 NA 9.53E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210594191 NA 2.84E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 5.34E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 7.98E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 1.34E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 1.36E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 1.38E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 2.28E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 9.72E-07 mr1030_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 6.66E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 5.38E-08 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 3.68E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 6.83E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 7.23E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 4.15E-08 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 4.86E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 3.31E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210594191 NA 4.61E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251