\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0210489813:

Variant ID: vg0210489813 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 10489813
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGATATATACAGGGGGGCCTGTCTGCCTGCATGTTTTGGTTGACATGATCTTGGACATGAGAGAGCCGGGTTATTGATTTGTTTTGGTGGCCGCCGGGC[C/A]
CAACCTGGCATCAACGCTCTCCCTTCTATTGTATGCCCTCTCTCCAATCTTCTTATTTCTTCATCACTTGCTGCTCTGTTACATTGCTTCGTGCAACTGA

Reverse complement sequence

TCAGTTGCACGAAGCAATGTAACAGAGCAGCAAGTGATGAAGAAATAAGAAGATTGGAGAGAGGGCATACAATAGAAGGGAGAGCGTTGATGCCAGGTTG[G/T]
GCCCGGCGGCCACCAAAACAAATCAATAACCCGGCTCTCTCATGTCCAAGATCATGTCAACCAAAACATGCAGGCAGACAGGCCCCCCTGTATATATCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 7.40% 4.02% 40.71% NA
All Indica  2759 32.70% 0.40% 3.15% 63.83% NA
All Japonica  1512 71.00% 22.00% 5.69% 1.26% NA
Aus  269 52.80% 0.00% 4.09% 43.12% NA
Indica I  595 43.70% 0.70% 5.38% 50.25% NA
Indica II  465 21.50% 0.60% 3.44% 74.41% NA
Indica III  913 34.10% 0.00% 2.08% 63.86% NA
Indica Intermediate  786 29.30% 0.40% 2.54% 67.81% NA
Temperate Japonica  767 50.80% 39.40% 8.74% 1.04% NA
Tropical Japonica  504 94.60% 1.60% 1.98% 1.79% NA
Japonica Intermediate  241 85.90% 9.50% 3.73% 0.83% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 55.60% 7.80% 6.67% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0210489813 C -> A LOC_Os02g18070.1 upstream_gene_variant ; 633.0bp to feature; MODIFIER silent_mutation Average:50.883; most accessible tissue: Zhenshan97 flag leaf, score: 96.192 N N N N
vg0210489813 C -> A LOC_Os02g18064.1 downstream_gene_variant ; 1124.0bp to feature; MODIFIER silent_mutation Average:50.883; most accessible tissue: Zhenshan97 flag leaf, score: 96.192 N N N N
vg0210489813 C -> A LOC_Os02g18064-LOC_Os02g18070 intergenic_region ; MODIFIER silent_mutation Average:50.883; most accessible tissue: Zhenshan97 flag leaf, score: 96.192 N N N N
vg0210489813 C -> DEL N N silent_mutation Average:50.883; most accessible tissue: Zhenshan97 flag leaf, score: 96.192 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0210489813 C A -0.32 -0.21 -0.15 -0.24 -0.3 -0.29

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0210489813 NA 2.46E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210489813 NA 1.14E-09 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0210489813 NA 1.13E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 7.98E-06 5.90E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 NA 4.56E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 NA 1.74E-11 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 NA 2.47E-08 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 NA 2.02E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 NA 7.58E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 NA 1.63E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 4.99E-07 2.72E-11 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 NA 1.58E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 1.26E-07 2.87E-17 mr1902_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0210489813 NA 2.30E-08 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251