Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204007916:

Variant ID: vg0204007916 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4007916
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:

TTGATTTCTTCAGTTACCAACAAATTATTATACTGCATTCCGAGTATATACGAAACAATAGAATAGAGATAAAAAAATCCATTTTATAAACTTAAACTTG[A/T]
ACCAAAGGTCCAAAAATCAGCCATAATTTTATTTTATCTTTTTACCAAAACCATTTGTCCTTGAAGGTTGTGCTAGAGAGGTGTGAATTTTGTTTCTTAT

Reverse complement sequence

ATAAGAAACAAAATTCACACCTCTCTAGCACAACCTTCAAGGACAAATGGTTTTGGTAAAAAGATAAAATAAAATTATGGCTGATTTTTGGACCTTTGGT[T/A]
CAAGTTTAAGTTTATAAAATGGATTTTTTTATCTCTATTCTATTGTTTCGTATATACTCGGAATGCAGTATAATAATTTGTTGGTAACTGAAGAAATCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.50%	13.30%	0.21%	0.00%	NA
All Indica	2759	99.70%	0.30%	0.00%	0.00%	NA
All Japonica	1512	59.50%	39.80%	0.66%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	31.40%	67.70%	0.91%	0.00%	NA
Tropical Japonica	504	96.60%	3.00%	0.40%	0.00%	NA
Japonica Intermediate	241	71.40%	28.20%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204007916	A -> T	LOC_Os02g07690.1	upstream_gene_variant ; 1075.0bp to feature; MODIFIER	silent_mutation	Average:63.548; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0204007916	A -> T	LOC_Os02g07680.5	downstream_gene_variant ; 1018.0bp to feature; MODIFIER	silent_mutation	Average:63.548; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0204007916	A -> T	LOC_Os02g07680-LOC_Os02g07690	intergenic_region ; MODIFIER	silent_mutation	Average:63.548; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204007916	NA	1.12E-09	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204007916	NA	1.14E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204007916	NA	6.99E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204007916	NA	7.70E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204007916	NA	3.65E-06	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	1.93E-26	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	1.54E-10	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	7.24E-08	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	7.40E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	6.69E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	9.79E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	7.44E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	4.53E-07	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	9.16E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	5.44E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	1.70E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	5.77E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	2.14E-15	mr1013_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	5.89E-15	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	4.21E-07	mr1129_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	6.04E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	2.56E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	1.82E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	8.97E-27	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	1.60E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	1.26E-07	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	5.29E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204007916	NA	3.01E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251