\
| Variant ID: vg0202346298 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2346298 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGCCATCGCACACACTGACACACCTCTCCCTCTCCCTCCTCACCACCACCACCACCCCCCCGCGCCCCGTGTCCTCGCCGTCGCCGTCCTGTCCCATCC[C/T]
GTGCGTCCTTGTTAACAATGAAATTTGGTAAGCCCAAAGTTATCATCGGCTTAGAGTTAATATTGGCTTCAAAGTTCTAGAATCAGCCGATAAGAGTTAA
TTAACTCTTATCGGCTGATTCTAGAACTTTGAAGCCAATATTAACTCTAAGCCGATGATAACTTTGGGCTTACCAAATTTCATTGTTAACAAGGACGCAC[G/A]
GGATGGGACAGGACGGCGACGGCGAGGACACGGGGCGCGGGGGGGTGGTGGTGGTGGTGAGGAGGGAGAGGGAGAGGTGTGTCAGTGTGTGCGATGGCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.30% | 16.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 56.00% | 43.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 89.00% | 11.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.70% | 87.90% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 43.20% | 56.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202346298 | C -> T | LOC_Os02g04970.1 | downstream_gene_variant ; 793.0bp to feature; MODIFIER | silent_mutation | Average:72.091; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| vg0202346298 | C -> T | LOC_Os02g04970-LOC_Os02g04980 | intergenic_region ; MODIFIER | silent_mutation | Average:72.091; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202346298 | 5.05E-07 | NA | Grain_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0202346298 | 5.83E-09 | 4.51E-13 | Grain_weight | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0202346298 | NA | 3.39E-06 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202346298 | NA | 7.66E-06 | mr1729 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202346298 | NA | 3.82E-10 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202346298 | NA | 4.36E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202346298 | NA | 8.61E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |