Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0143247814:

Variant ID: vg0143247814 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 43247814
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

CGTAGCAAAATAGAGTACAGTAATAAAATCCTATTACCAGTTGCAATAGTACAATGGAACTTAGTTGATTCCCATAATTTGTAGTATACACATGATGACA[T/C]
AAAAGGATGGATGGGGTCTAGTTGTACAAGAAGGGCTCTGCAACACTATTTTATCTCCATTACCAAATTCTCTGTAACACTATTCTATGTGCATTACCAA

Reverse complement sequence

TTGGTAATGCACATAGAATAGTGTTACAGAGAATTTGGTAATGGAGATAAAATAGTGTTGCAGAGCCCTTCTTGTACAACTAGACCCCATCCATCCTTTT[A/G]
TGTCATCATGTGTATACTACAAATTATGGGAATCAACTAAGTTCCATTGTACTATTGCAACTGGTAATAGGATTTTATTACTGTACTCTATTTTGCTACG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.80%	19.60%	3.20%	35.38%	NA
All Indica	2759	18.30%	26.60%	4.13%	50.89%	NA
All Japonica	1512	90.40%	6.20%	1.46%	1.92%	NA
Aus	269	13.80%	1.10%	3.35%	81.78%	NA
Indica I	595	15.80%	0.30%	1.85%	82.02%	NA
Indica II	465	3.90%	69.70%	0.65%	25.81%	NA
Indica III	913	19.60%	25.40%	8.43%	46.55%	NA
Indica Intermediate	786	27.40%	22.50%	2.93%	47.20%	NA
Temperate Japonica	767	99.30%	0.40%	0.00%	0.26%	NA
Tropical Japonica	504	74.20%	16.90%	3.97%	4.96%	NA
Japonica Intermediate	241	95.90%	2.50%	0.83%	0.83%	NA
VI/Aromatic	96	24.00%	74.00%	1.04%	1.04%	NA
Intermediate	90	46.70%	27.80%	5.56%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0143247814	T -> DEL	N	N	silent_mutation	Average:42.167; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0143247814	T -> C	LOC_Os01g74660.1	downstream_gene_variant ; 2382.0bp to feature; MODIFIER	silent_mutation	Average:42.167; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0143247814	T -> C	LOC_Os01g74670.1	intron_variant ; MODIFIER	silent_mutation	Average:42.167; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0143247814	NA	8.79E-14	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0143247814	NA	9.17E-08	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0143247814	NA	2.30E-06	mr1042	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	3.10E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	9.46E-06	mr1269	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	1.26E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	7.53E-07	mr1399	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	5.92E-07	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	3.60E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	1.20E-07	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	3.82E-06	mr1919	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	9.93E-08	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	1.77E-07	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	4.96E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	2.51E-08	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	2.24E-07	mr1904_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	9.71E-07	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0143247814	NA	4.67E-08	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251