Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142590577:

Variant ID: vg0142590577 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 42590577
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

GAATGCTTGATGGAGATTCTTCGCCGCGCCGAGCAGACGACCAAGACCAAGACTTTCATATGACAGAAACAGCACCCTAGCTTTTCCTGTTACATCTCAA[A/G]
TTGTATTTATTTTGTTCGCCTAGCACCTAAGGGAGAGAAGAATGGAAGGAGGAAGTAGAAAGAAAGTCAGTTTCATCAGTACATAATCACAGGTGTTGCT

Reverse complement sequence

AGCAACACCTGTGATTATGTACTGATGAAACTGACTTTCTTTCTACTTCCTCCTTCCATTCTTCTCTCCCTTAGGTGCTAGGCGAACAAAATAAATACAA[T/C]
TTGAGATGTAACAGGAAAAGCTAGGGTGCTGTTTCTGTCATATGAAAGTCTTGGTCTTGGTCGTCTGCTCGGCGCGGCGAAGAATCTCCATCAAGCATTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.20%	17.20%	0.17%	0.40%	NA
All Indica	2759	76.50%	22.50%	0.25%	0.69%	NA
All Japonica	1512	88.20%	11.80%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	89.60%	9.40%	0.50%	0.50%	NA
Indica II	465	34.20%	64.10%	0.22%	1.51%	NA
Indica III	913	88.30%	11.40%	0.00%	0.33%	NA
Indica Intermediate	786	78.10%	20.70%	0.38%	0.76%	NA
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	73.40%	26.60%	0.00%	0.00%	NA
Japonica Intermediate	241	89.60%	10.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0142590577	A -> G	LOC_Os01g73490.1	upstream_gene_variant ; 4507.0bp to feature; MODIFIER	silent_mutation	Average:93.398; most accessible tissue: Minghui63 flower, score: 98.199	N	N	N	N
vg0142590577	A -> G	LOC_Os01g73500.1	upstream_gene_variant ; 243.0bp to feature; MODIFIER	silent_mutation	Average:93.398; most accessible tissue: Minghui63 flower, score: 98.199	N	N	N	N
vg0142590577	A -> G	LOC_Os01g73500.2	upstream_gene_variant ; 239.0bp to feature; MODIFIER	silent_mutation	Average:93.398; most accessible tissue: Minghui63 flower, score: 98.199	N	N	N	N
vg0142590577	A -> G	LOC_Os01g73514.1	downstream_gene_variant ; 304.0bp to feature; MODIFIER	silent_mutation	Average:93.398; most accessible tissue: Minghui63 flower, score: 98.199	N	N	N	N
vg0142590577	A -> G	LOC_Os01g73500-LOC_Os01g73514	intergenic_region ; MODIFIER	silent_mutation	Average:93.398; most accessible tissue: Minghui63 flower, score: 98.199	N	N	N	N
vg0142590577	A -> DEL	N	N	silent_mutation	Average:93.398; most accessible tissue: Minghui63 flower, score: 98.199	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0142590577	A	G	0.0	0.01	-0.01	-0.03	-0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0142590577	NA	1.42E-16	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142590577	NA	4.16E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	1.33E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	7.96E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	6.20E-06	mr1433	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	1.10E-06	mr1500	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	1.82E-06	mr1501	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	4.04E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	3.98E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	4.54E-07	mr1629	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	7.72E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	6.61E-12	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	4.20E-06	8.62E-09	mr1919	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	8.54E-06	mr1923	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	9.69E-08	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	3.03E-10	8.54E-17	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	3.83E-09	5.53E-16	mr1974	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	1.48E-06	mr1984	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	5.02E-07	mr1984	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	4.91E-08	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	NA	6.99E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	2.29E-08	1.79E-12	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142590577	5.15E-07	1.18E-11	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251