\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142354163:

Variant ID: vg0142354163 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42354163
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.10, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ACCATTCATTGCTTTTGGTGAAGTCAATACCAAGAATCAGATTTGATGACTCAAGACCAGCGTCTCTCAACGCAGCAGTAACCTTCAAAATCAAAACAGG[T/C]
AACAGGTTACGTACAAGCAGATGCTGCAGGCATCATTTTCCTGTAGTGAAGAATATTCGAGCTTGAAAAATATTGGTAAGAAATTTTGGAGAATAAACTT

Reverse complement sequence

AAGTTTATTCTCCAAAATTTCTTACCAATATTTTTCAAGCTCGAATATTCTTCACTACAGGAAAATGATGCCTGCAGCATCTGCTTGTACGTAACCTGTT[A/G]
CCTGTTTTGATTTTGAAGGTTACTGCTGCGTTGAGAGACGCTGGTCTTGAGTCATCAAATCTGATTCTTGGTATTGACTTCACCAAAAGCAATGAATGGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 16.20% 2.16% 0.72% NA
All Indica  2759 76.00% 20.70% 2.57% 0.76% NA
All Japonica  1512 89.30% 8.10% 1.85% 0.79% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 92.60% 0.00% 6.55% 0.84% NA
Indica II  465 29.00% 69.00% 0.22% 1.72% NA
Indica III  913 86.70% 12.80% 0.33% 0.11% NA
Indica Intermediate  786 78.80% 16.80% 3.56% 0.89% NA
Temperate Japonica  767 98.60% 0.40% 0.78% 0.26% NA
Tropical Japonica  504 71.80% 22.60% 3.77% 1.79% NA
Japonica Intermediate  241 96.30% 2.10% 1.24% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 78.90% 16.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142354163 T -> DEL N N silent_mutation Average:52.882; most accessible tissue: Zhenshan97 flower, score: 70.756 N N N N
vg0142354163 T -> C LOC_Os01g72990.1 upstream_gene_variant ; 4764.0bp to feature; MODIFIER silent_mutation Average:52.882; most accessible tissue: Zhenshan97 flower, score: 70.756 N N N N
vg0142354163 T -> C LOC_Os01g73005.1 downstream_gene_variant ; 3920.0bp to feature; MODIFIER silent_mutation Average:52.882; most accessible tissue: Zhenshan97 flower, score: 70.756 N N N N
vg0142354163 T -> C LOC_Os01g73000.1 intron_variant ; MODIFIER silent_mutation Average:52.882; most accessible tissue: Zhenshan97 flower, score: 70.756 N N N N
vg0142354163 T -> C LOC_Os01g73000.2 intron_variant ; MODIFIER silent_mutation Average:52.882; most accessible tissue: Zhenshan97 flower, score: 70.756 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142354163 NA 1.68E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142354163 NA 1.07E-16 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142354163 NA 1.06E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142354163 NA 5.18E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 1.48E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 6.07E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 2.40E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 1.95E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 1.29E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 2.49E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 7.04E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 2.38E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 2.09E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 3.28E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 1.70E-07 9.55E-11 mr1919 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 8.86E-09 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 1.81E-06 1.58E-12 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 1.55E-06 2.50E-13 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 3.42E-06 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 1.95E-15 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 1.17E-07 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 2.13E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 1.03E-07 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 2.00E-08 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 4.61E-09 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 2.16E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 5.64E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 1.98E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 6.34E-06 mr1438_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 1.62E-08 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 2.65E-08 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 3.11E-06 mr1928_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 3.31E-08 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 1.46E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 3.08E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 NA 2.78E-07 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142354163 9.82E-08 2.02E-11 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251