\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142347941:

Variant ID: vg0142347941 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42347941
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, A: 0.37, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ATTACCTTCCCAAGGTGCAGTGATCTGTGCTTCTGTTCTTTGCACCAAGTAGAACATGAAGATAATGGAGCAAAGATAGAAGAGTCGAGACTGCCGCATG[A/C]
TGCTACTACACAGAAAATTTGCTCAGTTTGGCAGGATATTGAGAATTCACCGATGTAGTTTCCCTTTGATAGCATAATCCAGTCCCTGAAATGGAACAAA

Reverse complement sequence

TTTGTTCCATTTCAGGGACTGGATTATGCTATCAAAGGGAAACTACATCGGTGAATTCTCAATATCCTGCCAAACTGAGCAAATTTTCTGTGTAGTAGCA[T/G]
CATGCGGCAGTCTCGACTCTTCTATCTTTGCTCCATTATCTTCATGTTCTACTTGGTGCAAAGAACAGAAGCACAGATCACTGCACCTTGGGAAGGTAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 16.20% 0.02% 0.28% NA
All Indica  2759 78.90% 20.60% 0.04% 0.40% NA
All Japonica  1512 91.80% 8.10% 0.00% 0.07% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 29.70% 69.00% 0.00% 1.29% NA
Indica III  913 87.20% 12.70% 0.00% 0.11% NA
Indica Intermediate  786 82.60% 16.80% 0.13% 0.51% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 77.20% 22.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142347941 A -> DEL N N silent_mutation Average:67.844; most accessible tissue: Callus, score: 79.402 N N N N
vg0142347941 A -> C LOC_Os01g72990.1 5_prime_UTR_variant ; 2.0bp to feature; MODIFIER silent_mutation Average:67.844; most accessible tissue: Callus, score: 79.402 N N N N
vg0142347941 A -> C LOC_Os01g72990.2 5_prime_UTR_variant ; 2.0bp to feature; MODIFIER silent_mutation Average:67.844; most accessible tissue: Callus, score: 79.402 N N N N
vg0142347941 A -> C LOC_Os01g73000.1 downstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:67.844; most accessible tissue: Callus, score: 79.402 N N N N
vg0142347941 A -> C LOC_Os01g73000.2 downstream_gene_variant ; 3002.0bp to feature; MODIFIER silent_mutation Average:67.844; most accessible tissue: Callus, score: 79.402 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142347941 NA 2.43E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142347941 NA 9.86E-17 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142347941 NA 2.00E-12 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142347941 NA 5.18E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 4.23E-08 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 8.22E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.28E-07 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 3.63E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 5.37E-07 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 7.91E-06 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 2.14E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 4.81E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 2.25E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.74E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 5.62E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 1.41E-07 1.06E-10 mr1919 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 3.11E-09 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 2.95E-06 2.02E-12 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 2.72E-06 4.87E-13 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 7.79E-06 mr1984 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.22E-15 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.31E-07 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 4.17E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.40E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 4.33E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.56E-07 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.66E-08 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 5.31E-09 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 9.16E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 4.25E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.11E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 5.15E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 3.51E-06 mr1438_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 2.08E-08 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.53E-07 mr1928_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 3.01E-08 mr1931_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.81E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 2.43E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 NA 1.23E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142347941 3.60E-07 7.78E-11 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251