\
| Variant ID: vg0142082183 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 42082183 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 336. )
GTACGAGTCATGTACTCATGTATGCTTTTAGCATTTATACTGTTATGGTCTTTATCACTGAAGGATTGTTTTGATCTATCAGATTACGGTTGCATTCAGA[A/G]
GTGACAGATCGAGTGTCAAATTAGAACACTTAATGCTCATATGCGCCAGCAAGACTCTGCTGCCGAATGCTCAATCTTTTTCACACAATGAATGTTCAAT
ATTGAACATTCATTGTGTGAAAAAGATTGAGCATTCGGCAGCAGAGTCTTGCTGGCGCATATGAGCATTAAGTGTTCTAATTTGACACTCGATCTGTCAC[T/C]
TCTGAATGCAACCGTAATCTGATAGATCAAAACAATCCTTCAGTGATAAAGACCATAACAGTATAAATGCTAAAAGCATACATGAGTACATGACTCGTAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.70% | 8.10% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 76.10% | 23.30% | 0.53% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 4.70% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 51.80% | 47.40% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.20% | 32.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0142082183 | A -> G | LOC_Os01g72540.1 | upstream_gene_variant ; 3046.0bp to feature; MODIFIER | silent_mutation | Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 | N | N | N | N |
| vg0142082183 | A -> G | LOC_Os01g72570.1 | upstream_gene_variant ; 4292.0bp to feature; MODIFIER | silent_mutation | Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 | N | N | N | N |
| vg0142082183 | A -> G | LOC_Os01g72570.2 | upstream_gene_variant ; 4292.0bp to feature; MODIFIER | silent_mutation | Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 | N | N | N | N |
| vg0142082183 | A -> G | LOC_Os01g72570.3 | upstream_gene_variant ; 4292.0bp to feature; MODIFIER | silent_mutation | Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 | N | N | N | N |
| vg0142082183 | A -> G | LOC_Os01g72550.1 | downstream_gene_variant ; 1627.0bp to feature; MODIFIER | silent_mutation | Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 | N | N | N | N |
| vg0142082183 | A -> G | LOC_Os01g72560.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0142082183 | 6.33E-06 | NA | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0142082183 | NA | 3.75E-19 | Grain_length | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0142082183 | 9.39E-09 | 1.30E-15 | Grain_weight | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0142082183 | NA | 6.43E-07 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0142082183 | NA | 2.37E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142082183 | NA | 5.13E-08 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142082183 | NA | 1.26E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142082183 | NA | 9.70E-07 | mr1851 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142082183 | NA | 6.43E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0142082183 | NA | 3.73E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |