\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0142082183:

Variant ID: vg0142082183 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 42082183
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:


GTACGAGTCATGTACTCATGTATGCTTTTAGCATTTATACTGTTATGGTCTTTATCACTGAAGGATTGTTTTGATCTATCAGATTACGGTTGCATTCAGA[A/G]
GTGACAGATCGAGTGTCAAATTAGAACACTTAATGCTCATATGCGCCAGCAAGACTCTGCTGCCGAATGCTCAATCTTTTTCACACAATGAATGTTCAAT

Reverse complement sequence

ATTGAACATTCATTGTGTGAAAAAGATTGAGCATTCGGCAGCAGAGTCTTGCTGGCGCATATGAGCATTAAGTGTTCTAATTTGACACTCGATCTGTCAC[T/C]
TCTGAATGCAACCGTAATCTGATAGATCAAAACAATCCTTCAGTGATAAAGACCATAACAGTATAAATGCTAAAAGCATACATGAGTACATGACTCGTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 8.10% 0.17% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 76.10% 23.30% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 94.90% 4.70% 0.39% 0.00% NA
Tropical Japonica  504 51.80% 47.40% 0.79% 0.00% NA
Japonica Intermediate  241 67.20% 32.40% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0142082183 A -> G LOC_Os01g72540.1 upstream_gene_variant ; 3046.0bp to feature; MODIFIER silent_mutation Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 N N N N
vg0142082183 A -> G LOC_Os01g72570.1 upstream_gene_variant ; 4292.0bp to feature; MODIFIER silent_mutation Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 N N N N
vg0142082183 A -> G LOC_Os01g72570.2 upstream_gene_variant ; 4292.0bp to feature; MODIFIER silent_mutation Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 N N N N
vg0142082183 A -> G LOC_Os01g72570.3 upstream_gene_variant ; 4292.0bp to feature; MODIFIER silent_mutation Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 N N N N
vg0142082183 A -> G LOC_Os01g72550.1 downstream_gene_variant ; 1627.0bp to feature; MODIFIER silent_mutation Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 N N N N
vg0142082183 A -> G LOC_Os01g72560.1 intron_variant ; MODIFIER silent_mutation Average:60.657; most accessible tissue: Zhenshan97 flower, score: 84.409 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0142082183 6.33E-06 NA Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142082183 NA 3.75E-19 Grain_length Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142082183 9.39E-09 1.30E-15 Grain_weight All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142082183 NA 6.43E-07 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0142082183 NA 2.37E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183 NA 5.13E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183 NA 1.26E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183 NA 9.70E-07 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183 NA 6.43E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0142082183 NA 3.73E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251