\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141835378:

Variant ID: vg0141835378 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41835378
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGAAAAATTATAAATAAAAAAAATTCGTTTCCAACTTTCTATTATGGCCCTATTTAGTTCTCAAAACAAAAATTTTCACGTTGTCACATCAAATATTT[G/A]
GACACATACATGGAGTATTAAATATAGGGAAAAAAAATCCAATTACACAGATTGCGAGACGAATCTTTTAAGACCCTGTTTCTTTCAGCTTGGGATTATT

Reverse complement sequence

AATAATCCCAAGCTGAAAGAAACAGGGTCTTAAAAGATTCGTCTCGCAATCTGTGTAATTGGATTTTTTTTCCCTATATTTAATACTCCATGTATGTGTC[C/T]
AAATATTTGATGTGACAACGTGAAAATTTTTGTTTTGAGAACTAAATAGGGCCATAATAGAAAGTTGGAAACGAATTTTTTTTATTTATAATTTTTCTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.30% 0.32% 0.00% NA
All Indica  2759 64.00% 35.60% 0.40% 0.00% NA
All Japonica  1512 46.60% 53.30% 0.13% 0.00% NA
Aus  269 59.50% 40.50% 0.00% 0.00% NA
Indica I  595 87.70% 11.90% 0.34% 0.00% NA
Indica II  465 29.70% 69.50% 0.86% 0.00% NA
Indica III  913 65.10% 34.60% 0.33% 0.00% NA
Indica Intermediate  786 65.00% 34.70% 0.25% 0.00% NA
Temperate Japonica  767 76.30% 23.70% 0.00% 0.00% NA
Tropical Japonica  504 12.30% 87.50% 0.20% 0.00% NA
Japonica Intermediate  241 23.70% 75.90% 0.41% 0.00% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141835378 G -> A LOC_Os01g72110.1 upstream_gene_variant ; 940.0bp to feature; MODIFIER silent_mutation Average:71.684; most accessible tissue: Zhenshan97 flag leaf, score: 89.88 N N N N
vg0141835378 G -> A LOC_Os01g72120.1 upstream_gene_variant ; 4571.0bp to feature; MODIFIER silent_mutation Average:71.684; most accessible tissue: Zhenshan97 flag leaf, score: 89.88 N N N N
vg0141835378 G -> A LOC_Os01g72110-LOC_Os01g72120 intergenic_region ; MODIFIER silent_mutation Average:71.684; most accessible tissue: Zhenshan97 flag leaf, score: 89.88 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141835378 NA 6.00E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141835378 NA 2.79E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 1.87E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 2.42E-08 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 3.60E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 9.74E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 3.25E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 4.40E-09 mr1263 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 7.85E-06 mr1263 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 4.40E-09 mr1451 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 7.85E-06 mr1451 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 2.91E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 5.22E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 1.96E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 7.38E-07 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 3.29E-07 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 2.55E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 5.18E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 4.19E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 9.81E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 1.93E-06 mr1472_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 1.98E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 1.36E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 4.53E-06 1.59E-08 mr1544_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 6.44E-07 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 3.77E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 6.68E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 3.32E-08 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 6.89E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 3.91E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141835378 NA 2.24E-06 mr1984_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251