| Variant ID: vg0140491505 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 40491505 |
| Reference Allele: GT | Alternative Allele: G,GTT,AT,GTTT |
| Primary Allele: G | Secondary Allele: GT |
Inferred Ancestral Allele: Not determined.
GTTATTAGTACATATGGGTTACTGTAGCACTTATGGCTAATCATGGACTAATTAGACTCAAAAGATTCATCTCGCAATTTACATGCAAACTGTGTAATTA[GT/G,GTT,AT,GTTT]
TTTTTTATCTATATTTAATGCTTCATATATGTGTCAAAAGATTCGATGTAATGTTTTTACGAAAATTTTTTGGGAACTAACCAGGGCTAATTAAATTAAT
ATTAATTTAATTAGCCCTGGTTAGTTCCCAAAAAATTTTCGTAAAAACATTACATCGAATCTTTTGACACATATATGAAGCATTAAATATAGATAAAAAA[AC/C,AAC,AT,AAAC]
TAATTACACAGTTTGCATGTAAATTGCGAGATGAATCTTTTGAGTCTAATTAGTCCATGATTAGCCATAAGTGCTACAGTAACCCATATGTACTAATAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of GT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.50% | 29.00% | 0.38% | 0.00% | GTT: 15.93%; AT: 12.15%; GTTT: 0.02% |
| All Indica | 2759 | 66.30% | 15.30% | 0.36% | 0.00% | GTT: 17.80%; AT: 0.25% |
| All Japonica | 1512 | 1.00% | 60.50% | 0.40% | 0.00% | AT: 36.51%; GTT: 1.59% |
| Aus | 269 | 51.70% | 0.40% | 0.00% | 0.00% | GTT: 47.58%; GTTT: 0.37% |
| Indica I | 595 | 66.40% | 30.90% | 0.17% | 0.00% | GTT: 2.52% |
| Indica II | 465 | 87.30% | 9.20% | 0.22% | 0.00% | GTT: 2.80%; AT: 0.43% |
| Indica III | 913 | 60.20% | 3.90% | 0.22% | 0.00% | GTT: 35.16%; AT: 0.44% |
| Indica Intermediate | 786 | 60.80% | 20.20% | 0.76% | 0.00% | GTT: 18.07%; AT: 0.13% |
| Temperate Japonica | 767 | 0.10% | 93.40% | 0.65% | 0.00% | AT: 5.61%; GTT: 0.26% |
| Tropical Japonica | 504 | 1.80% | 19.60% | 0.20% | 0.00% | AT: 75.99%; GTT: 2.38% |
| Japonica Intermediate | 241 | 2.10% | 41.50% | 0.00% | 0.00% | AT: 52.28%; GTT: 4.15% |
| VI/Aromatic | 96 | 0.00% | 5.20% | 0.00% | 0.00% | GTT: 94.79% |
| Intermediate | 90 | 30.00% | 30.00% | 2.22% | 0.00% | GTT: 21.11%; AT: 16.67% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0140491505 | GT -> G | LOC_Os01g69990.1 | upstream_gene_variant ; 1846.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> G | LOC_Os01g70000.1 | upstream_gene_variant ; 2188.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> G | LOC_Os01g70010.1 | downstream_gene_variant ; 4837.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> G | LOC_Os01g69990-LOC_Os01g70000 | intergenic_region ; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> GTT | LOC_Os01g69990.1 | upstream_gene_variant ; 1847.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> GTT | LOC_Os01g70000.1 | upstream_gene_variant ; 2187.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> GTT | LOC_Os01g70010.1 | downstream_gene_variant ; 4836.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> GTT | LOC_Os01g69990-LOC_Os01g70000 | intergenic_region ; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> AT | LOC_Os01g69990.1 | upstream_gene_variant ; 1845.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> AT | LOC_Os01g70000.1 | upstream_gene_variant ; 2189.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> AT | LOC_Os01g70010.1 | downstream_gene_variant ; 4838.0bp to feature; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> AT | LOC_Os01g69990-LOC_Os01g70000 | intergenic_region ; MODIFIER | silent_mutation | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> GTTT | LOC_Os01g69990.1 | upstream_gene_variant ; 1847.0bp to feature; MODIFIER | N | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> GTTT | LOC_Os01g70000.1 | upstream_gene_variant ; 2187.0bp to feature; MODIFIER | N | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> GTTT | LOC_Os01g70010.1 | downstream_gene_variant ; 4836.0bp to feature; MODIFIER | N | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg0140491505 | GT -> GTTT | LOC_Os01g69990-LOC_Os01g70000 | intergenic_region ; MODIFIER | N | Average:65.179; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0140491505 | 7.38E-06 | NA | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0140491505 | NA | 5.95E-23 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 2.89E-08 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 8.54E-13 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 6.37E-09 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 1.70E-06 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 3.18E-20 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 6.81E-09 | mr1383_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 3.97E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 3.66E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 4.09E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 6.11E-09 | mr1502_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 5.30E-12 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 1.23E-09 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 5.32E-06 | mr1621_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 5.78E-12 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 5.17E-06 | mr1722_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 1.99E-17 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 7.40E-09 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 1.25E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 9.78E-10 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 9.91E-13 | mr1864_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 5.14E-24 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140491505 | NA | 6.57E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |