\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138163036:

Variant ID: vg0138163036 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38163036
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, A: 0.13, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


ACATCCTTAAAAATAGGAGTATACTCTCTCTCCGTATAAAGAAAACAACCTAGTACTATTAAAATAAGACATAACTTAGTACCACAAATATAAAAAAAGT[T/C,A]
TGTCTAGATTCGCTGCTGTATTAGGTTATATCCAATCTAATAATAGCTTTTTTTAAGAGAGAATCTCTTATATGCCACTGAAAATTGGTCATATCCCTTA

Reverse complement sequence

TAAGGGATATGACCAATTTTCAGTGGCATATAAGAGATTCTCTCTTAAAAAAAGCTATTATTAGATTGGATATAACCTAATACAGCAGCGAATCTAGACA[A/G,T]
ACTTTTTTTATATTTGTGGTACTAAGTTATGTCTTATTTTAATAGTACTAGGTTGTTTTCTTTATACGGAGAGAGAGTATACTCCTATTTTTAAGGATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 34.80% 0.08% 0.00% A: 0.80%
All Indica  2759 97.40% 1.70% 0.11% 0.00% A: 0.80%
All Japonica  1512 3.00% 96.90% 0.07% 0.00% A: 0.07%
Aus  269 95.50% 0.40% 0.00% 0.00% A: 4.09%
Indica I  595 99.00% 0.00% 0.00% 0.00% A: 1.01%
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 92.60% 5.10% 0.38% 0.00% A: 1.91%
Temperate Japonica  767 3.00% 96.90% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.40% 0.00% 0.00% A: 0.41%
VI/Aromatic  96 2.10% 93.80% 0.00% 0.00% A: 4.17%
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138163036 T -> A LOC_Os01g65730.1 upstream_gene_variant ; 3251.0bp to feature; MODIFIER silent_mutation Average:52.704; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0138163036 T -> A LOC_Os01g65740.1 upstream_gene_variant ; 1501.0bp to feature; MODIFIER silent_mutation Average:52.704; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0138163036 T -> A LOC_Os01g65730-LOC_Os01g65740 intergenic_region ; MODIFIER silent_mutation Average:52.704; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0138163036 T -> C LOC_Os01g65730.1 upstream_gene_variant ; 3251.0bp to feature; MODIFIER silent_mutation Average:52.704; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0138163036 T -> C LOC_Os01g65740.1 upstream_gene_variant ; 1501.0bp to feature; MODIFIER silent_mutation Average:52.704; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0138163036 T -> C LOC_Os01g65730-LOC_Os01g65740 intergenic_region ; MODIFIER silent_mutation Average:52.704; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138163036 NA 2.82E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138163036 NA 9.72E-102 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 4.99E-100 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 6.18E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 3.95E-27 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 3.77E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 4.57E-45 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 5.02E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 5.01E-23 1.06E-115 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 9.15E-10 9.92E-15 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.98E-22 1.66E-112 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.97E-08 6.06E-12 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 2.33E-45 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 9.32E-50 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.23E-07 5.83E-32 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 3.05E-06 3.05E-06 mr1375 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 7.20E-20 2.24E-125 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 1.97E-08 2.69E-14 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 5.75E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.73E-09 8.46E-106 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 6.70E-10 2.88E-82 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.12E-07 1.13E-10 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.19E-13 4.23E-49 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 6.11E-06 6.11E-06 mr1670 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 3.15E-18 1.34E-114 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 2.52E-07 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 3.41E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 9.36E-22 2.57E-127 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 5.89E-15 5.93E-30 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 9.35E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 5.12E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 1.31E-18 1.20E-116 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.61E-16 4.78E-31 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.46E-12 8.11E-162 mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 5.49E-06 2.79E-08 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 5.34E-13 3.26E-126 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.24E-08 1.22E-13 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 3.63E-42 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.72E-16 1.85E-64 mr1670_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 2.42E-06 2.42E-06 mr1670_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 4.91E-21 8.76E-157 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 7.19E-06 2.30E-14 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 6.54E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 4.88E-07 mr1946_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138163036 NA 4.88E-07 mr1948_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251