\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138155829:

Variant ID: vg0138155829 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38155829
Reference Allele: GAlternative Allele: T,C
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, T: 0.31, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGTATAAATTCTAGTATAATATCTTCCTTGTTTTAGTGACTGGTTATCTTAGCAATTTGTTCTGATACCAAAAAAAAAAAGGTACAACAATGGATTTT[G/T,C]
AGACAAGTCTGTGGCTGATTGGTCCTTAAGTACGTATGTACTGATAAGTGGTTGTCTTTATAATTTTCCAGGTTGACATTATTGGGGTAAGCTGCTACTC

Reverse complement sequence

GAGTAGCAGCTTACCCCAATAATGTCAACCTGGAAAATTATAAAGACAACCACTTATCAGTACATACGTACTTAAGGACCAATCAGCCACAGACTTGTCT[C/A,G]
AAAATCCATTGTTGTACCTTTTTTTTTTTGGTATCAGAACAAATTGCTAAGATAACCAGTCACTAAAACAAGGAAGATATTATACTAGAATTTATACTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 35.00% 0.08% 0.00% C: 0.02%
All Indica  2759 98.10% 1.70% 0.11% 0.00% C: 0.04%
All Japonica  1512 3.00% 97.00% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.00% C: 0.17%
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 94.40% 5.20% 0.38% 0.00% NA
Temperate Japonica  767 2.90% 97.00% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138155829 G -> T LOC_Os01g65710.1 downstream_gene_variant ; 3787.0bp to feature; MODIFIER silent_mutation Average:60.863; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0138155829 G -> T LOC_Os01g65730.1 downstream_gene_variant ; 1490.0bp to feature; MODIFIER silent_mutation Average:60.863; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0138155829 G -> T LOC_Os01g65720.1 intron_variant ; MODIFIER silent_mutation Average:60.863; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0138155829 G -> C LOC_Os01g65710.1 downstream_gene_variant ; 3787.0bp to feature; MODIFIER silent_mutation Average:60.863; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0138155829 G -> C LOC_Os01g65730.1 downstream_gene_variant ; 1490.0bp to feature; MODIFIER silent_mutation Average:60.863; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0138155829 G -> C LOC_Os01g65720.1 intron_variant ; MODIFIER silent_mutation Average:60.863; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138155829 NA 3.88E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138155829 NA 4.83E-28 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 1.82E-45 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 2.06E-25 2.97E-116 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 7.92E-13 2.61E-18 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 2.43E-25 2.29E-114 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 2.74E-11 2.84E-15 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 1.44E-44 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 3.91E-30 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.13E-22 1.23E-126 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.01E-11 1.48E-18 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.57E-10 3.67E-108 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 2.68E-10 3.79E-83 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.02E-07 3.26E-11 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 6.75E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 9.69E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.90E-13 3.06E-49 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 3.78E-07 3.78E-07 mr1670 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.57E-19 3.32E-115 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.09E-06 7.90E-09 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 5.44E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 2.46E-88 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 1.38E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.65E-26 1.00E-129 mr1134_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 7.19E-20 6.25E-38 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 2.40E-39 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 3.76E-50 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.47E-19 5.78E-117 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 6.62E-18 5.45E-34 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 3.68E-12 9.69E-162 mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 2.61E-07 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 7.96E-13 7.26E-125 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 2.78E-08 2.26E-13 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 7.11E-42 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.59E-15 2.66E-64 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 6.57E-06 6.57E-06 mr1670_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 4.58E-23 1.69E-157 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 1.25E-06 2.69E-15 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 3.33E-06 mr1946_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138155829 NA 3.33E-06 mr1948_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251