\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0138126205:

Variant ID: vg0138126205 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 38126205
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTTGTTGTTGATAACTTTTTCAGTTGAAATCATTTAGTATTTGAAAATGTTGTTTGAAGTTGTCATATTTTTAAATTCAAATTCAAACGGTTAAAAAA[T/A]
TGTTATATAGAAAAATGACCAAAATAAAAGATATAGATCTTGATGAGTTATTCAACTTTGTTATTGATGACTTTTTCAGTTGAAGTCGTTCACTAACAAA

Reverse complement sequence

TTTGTTAGTGAACGACTTCAACTGAAAAAGTCATCAATAACAAAGTTGAATAACTCATCAAGATCTATATCTTTTATTTTGGTCATTTTTCTATATAACA[A/T]
TTTTTTAACCGTTTGAATTTGAATTTAAAAATATGACAACTTCAAACAACATTTTCAAATACTAAATGATTTCAACTGAAAAAGTTATCAACAACAAAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 34.90% 0.25% 0.00% NA
All Indica  2759 98.00% 1.70% 0.25% 0.00% NA
All Japonica  1512 3.00% 96.90% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 94.70% 4.80% 0.51% 0.00% NA
Temperate Japonica  767 2.90% 97.00% 0.13% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.00% 0.41% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 46.70% 51.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0138126205 T -> A LOC_Os01g65660-LOC_Os01g65670 intergenic_region ; MODIFIER silent_mutation Average:12.491; most accessible tissue: Minghui63 flower, score: 20.805 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0138126205 NA 2.21E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0138126205 NA 4.56E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 NA 3.32E-44 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.44E-25 8.18E-113 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.98E-14 2.06E-19 mr1134 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 3.04E-23 7.45E-111 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 4.79E-12 5.06E-16 mr1135 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 NA 4.27E-29 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.15E-21 1.46E-122 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 4.15E-13 2.04E-19 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 3.72E-12 3.05E-108 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 8.82E-07 9.97E-08 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.22E-12 4.95E-84 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.30E-10 3.21E-14 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 NA 7.75E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 NA 3.96E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.53E-14 4.72E-50 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.42E-07 1.42E-07 mr1670 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.35E-18 1.02E-113 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.80E-07 7.75E-10 mr1672 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 NA 8.49E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 NA 2.12E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 3.98E-23 2.85E-122 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.22E-16 6.20E-33 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 2.37E-14 3.28E-109 mr1504_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.77E-15 5.86E-31 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 1.81E-10 7.78E-156 mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 NA 1.50E-07 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 9.43E-12 4.80E-122 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 3.75E-07 7.12E-13 mr1538_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 4.32E-06 2.78E-43 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 4.95E-13 8.26E-62 mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 2.76E-06 2.76E-06 mr1670_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 4.13E-20 1.12E-152 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 4.42E-06 2.24E-15 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0138126205 NA 5.68E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251