Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136251646:

Variant ID: vg0136251646 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 36251646
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTTACGTAGGAGTACTTTACTCGCTCTCTCTATATAGTGCAACGACCGTCAAGATATCTATAGTTCGTAGTAGTACTGGGTTTGCCATTCGTCAAACG[A/G]
TTTGCCTTCTCAAAAATGGCAGAAGGCGAGGAAAATTAGCCCCCTCACACACCTGACAAACCCTTGTTGCTGCACCAGAGCAAAGAACAAAATAAAACGC

Reverse complement sequence

GCGTTTTATTTTGTTCTTTGCTCTGGTGCAGCAACAAGGGTTTGTCAGGTGTGTGAGGGGGCTAATTTTCCTCGCCTTCTGCCATTTTTGAGAAGGCAAA[T/C]
CGTTTGACGAATGGCAAACCCAGTACTACTACGAACTATAGATATCTTGACGGTCGTTGCACTATATAGAGAGAGCGAGTAAAGTACTCCTACGTAAACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.00%	40.80%	0.04%	0.08%	NA
All Indica	2759	94.60%	5.30%	0.04%	0.11%	NA
All Japonica	1512	1.80%	98.20%	0.00%	0.00%	NA
Aus	269	45.40%	54.60%	0.00%	0.00%	NA
Indica I	595	90.10%	9.60%	0.17%	0.17%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	97.60%	2.40%	0.00%	0.00%	NA
Indica Intermediate	786	91.90%	7.90%	0.00%	0.25%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	2.80%	97.20%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	96.90%	0.00%	1.04%	NA
Intermediate	90	33.30%	65.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0136251646	A -> G	LOC_Os01g62605.1	upstream_gene_variant ; 308.0bp to feature; MODIFIER	silent_mutation	Average:71.858; most accessible tissue: Zhenshan97 panicle, score: 95.951	N	N	N	N
vg0136251646	A -> G	LOC_Os01g62610.1	upstream_gene_variant ; 1901.0bp to feature; MODIFIER	silent_mutation	Average:71.858; most accessible tissue: Zhenshan97 panicle, score: 95.951	N	N	N	N
vg0136251646	A -> G	LOC_Os01g62600-LOC_Os01g62605	intergenic_region ; MODIFIER	silent_mutation	Average:71.858; most accessible tissue: Zhenshan97 panicle, score: 95.951	N	N	N	N
vg0136251646	A -> DEL	N	N	silent_mutation	Average:71.858; most accessible tissue: Zhenshan97 panicle, score: 95.951	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0136251646	A	G	-0.01	-0.02	-0.02	0.0	-0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0136251646	NA	1.60E-19	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0136251646	NA	1.66E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	1.04E-09	mr1524	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	6.53E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	7.63E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	9.53E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	3.01E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	1.10E-12	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	4.95E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	1.62E-23	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	2.00E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	1.56E-33	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	NA	2.53E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646	4.09E-06	NA	mr1973_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251