\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0136251646:

Variant ID: vg0136251646 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 36251646
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTACGTAGGAGTACTTTACTCGCTCTCTCTATATAGTGCAACGACCGTCAAGATATCTATAGTTCGTAGTAGTACTGGGTTTGCCATTCGTCAAACG[A/G]
TTTGCCTTCTCAAAAATGGCAGAAGGCGAGGAAAATTAGCCCCCTCACACACCTGACAAACCCTTGTTGCTGCACCAGAGCAAAGAACAAAATAAAACGC

Reverse complement sequence

GCGTTTTATTTTGTTCTTTGCTCTGGTGCAGCAACAAGGGTTTGTCAGGTGTGTGAGGGGGCTAATTTTCCTCGCCTTCTGCCATTTTTGAGAAGGCAAA[T/C]
CGTTTGACGAATGGCAAACCCAGTACTACTACGAACTATAGATATCTTGACGGTCGTTGCACTATATAGAGAGAGCGAGTAAAGTACTCCTACGTAAACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.00% 40.80% 0.04% 0.08% NA
All Indica  2759 94.60% 5.30% 0.04% 0.11% NA
All Japonica  1512 1.80% 98.20% 0.00% 0.00% NA
Aus  269 45.40% 54.60% 0.00% 0.00% NA
Indica I  595 90.10% 9.60% 0.17% 0.17% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 97.60% 2.40% 0.00% 0.00% NA
Indica Intermediate  786 91.90% 7.90% 0.00% 0.25% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 0.00% 1.04% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0136251646 A -> G LOC_Os01g62605.1 upstream_gene_variant ; 308.0bp to feature; MODIFIER silent_mutation Average:71.858; most accessible tissue: Zhenshan97 panicle, score: 95.951 N N N N
vg0136251646 A -> G LOC_Os01g62610.1 upstream_gene_variant ; 1901.0bp to feature; MODIFIER silent_mutation Average:71.858; most accessible tissue: Zhenshan97 panicle, score: 95.951 N N N N
vg0136251646 A -> G LOC_Os01g62600-LOC_Os01g62605 intergenic_region ; MODIFIER silent_mutation Average:71.858; most accessible tissue: Zhenshan97 panicle, score: 95.951 N N N N
vg0136251646 A -> DEL N N silent_mutation Average:71.858; most accessible tissue: Zhenshan97 panicle, score: 95.951 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0136251646 A G -0.01 -0.02 -0.02 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0136251646 NA 1.60E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0136251646 NA 1.66E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 1.04E-09 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 6.53E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 7.63E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 9.53E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 3.01E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 1.10E-12 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 4.95E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 1.62E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 2.00E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 1.56E-33 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 NA 2.53E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0136251646 4.09E-06 NA mr1973_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251