\
| Variant ID: vg0135049651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 35049651 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )
AAAGTCTATTTTACCTCCCTCGGGTTCGATGGGCCGAATCCCTCTCGGCCCATCTCCCCCTCCCTCCCCGGCTCTCTCTCTCTCTCTCTCTCCCCGCTCT[T/G]
CCGTGAGCCGCGCCGAGCCCTCCCTCCCGCTCTCGCTGCCATTCCCGCCGATGCCGCCCAAATCGCCGCGCCGCCCGCGCGTGCGCGCGCGCCGTGGTGG
CCACCACGGCGCGCGCGCACGCGCGGGCGGCGCGGCGATTTGGGCGGCATCGGCGGGAATGGCAGCGAGAGCGGGAGGGAGGGCTCGGCGCGGCTCACGG[A/C]
AGAGCGGGGAGAGAGAGAGAGAGAGAGAGCCGGGGAGGGAGGGGGAGATGGGCCGAGAGGGATTCGGCCCATCGAACCCGAGGGAGGTAAAATAGACTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 11.30% | 1.02% | 0.42% | NA |
| All Indica | 2759 | 98.90% | 0.20% | 0.83% | 0.00% | NA |
| All Japonica | 1512 | 63.40% | 33.90% | 1.59% | 1.19% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 0.10% | 2.08% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 42.80% | 54.60% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 91.10% | 5.20% | 0.40% | 3.37% | NA |
| Japonica Intermediate | 241 | 71.00% | 27.80% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 16.70% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0135049651 | T -> G | LOC_Os01g60620.1 | upstream_gene_variant ; 1898.0bp to feature; MODIFIER | silent_mutation | Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688 | N | N | N | N |
| vg0135049651 | T -> G | LOC_Os01g60630.1 | downstream_gene_variant ; 3167.0bp to feature; MODIFIER | silent_mutation | Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688 | N | N | N | N |
| vg0135049651 | T -> G | LOC_Os01g60620-LOC_Os01g60630 | intergenic_region ; MODIFIER | silent_mutation | Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688 | N | N | N | N |
| vg0135049651 | T -> DEL | N | N | silent_mutation | Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0135049651 | NA | 1.13E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0135049651 | NA | 1.34E-09 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0135049651 | NA | 5.99E-15 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0135049651 | NA | 7.49E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135049651 | 3.65E-07 | NA | mr1100_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135049651 | NA | 3.71E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135049651 | NA | 4.71E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0135049651 | NA | 3.84E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |