\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135049651:

Variant ID: vg0135049651 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 35049651
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGTCTATTTTACCTCCCTCGGGTTCGATGGGCCGAATCCCTCTCGGCCCATCTCCCCCTCCCTCCCCGGCTCTCTCTCTCTCTCTCTCTCCCCGCTCT[T/G]
CCGTGAGCCGCGCCGAGCCCTCCCTCCCGCTCTCGCTGCCATTCCCGCCGATGCCGCCCAAATCGCCGCGCCGCCCGCGCGTGCGCGCGCGCCGTGGTGG

Reverse complement sequence

CCACCACGGCGCGCGCGCACGCGCGGGCGGCGCGGCGATTTGGGCGGCATCGGCGGGAATGGCAGCGAGAGCGGGAGGGAGGGCTCGGCGCGGCTCACGG[A/C]
AGAGCGGGGAGAGAGAGAGAGAGAGAGAGCCGGGGAGGGAGGGGGAGATGGGCCGAGAGGGATTCGGCCCATCGAACCCGAGGGAGGTAAAATAGACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 11.30% 1.02% 0.42% NA
All Indica  2759 98.90% 0.20% 0.83% 0.00% NA
All Japonica  1512 63.40% 33.90% 1.59% 1.19% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.80% 0.10% 2.08% 0.00% NA
Indica Intermediate  786 99.00% 0.50% 0.51% 0.00% NA
Temperate Japonica  767 42.80% 54.60% 2.61% 0.00% NA
Tropical Japonica  504 91.10% 5.20% 0.40% 3.37% NA
Japonica Intermediate  241 71.00% 27.80% 0.83% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 16.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0135049651 T -> G LOC_Os01g60620.1 upstream_gene_variant ; 1898.0bp to feature; MODIFIER silent_mutation Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg0135049651 T -> G LOC_Os01g60630.1 downstream_gene_variant ; 3167.0bp to feature; MODIFIER silent_mutation Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg0135049651 T -> G LOC_Os01g60620-LOC_Os01g60630 intergenic_region ; MODIFIER silent_mutation Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N
vg0135049651 T -> DEL N N silent_mutation Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0135049651 NA 1.13E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135049651 NA 1.34E-09 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135049651 NA 5.99E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135049651 NA 7.49E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135049651 3.65E-07 NA mr1100_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135049651 NA 3.71E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135049651 NA 4.71E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135049651 NA 3.84E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251