Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0135049651:

Variant ID: vg0135049651 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 35049651
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGTCTATTTTACCTCCCTCGGGTTCGATGGGCCGAATCCCTCTCGGCCCATCTCCCCCTCCCTCCCCGGCTCTCTCTCTCTCTCTCTCTCCCCGCTCT[T/G]
CCGTGAGCCGCGCCGAGCCCTCCCTCCCGCTCTCGCTGCCATTCCCGCCGATGCCGCCCAAATCGCCGCGCCGCCCGCGCGTGCGCGCGCGCCGTGGTGG

Reverse complement sequence

CCACCACGGCGCGCGCGCACGCGCGGGCGGCGCGGCGATTTGGGCGGCATCGGCGGGAATGGCAGCGAGAGCGGGAGGGAGGGCTCGGCGCGGCTCACGG[A/C]
AGAGCGGGGAGAGAGAGAGAGAGAGAGAGCCGGGGAGGGAGGGGGAGATGGGCCGAGAGGGATTCGGCCCATCGAACCCGAGGGAGGTAAAATAGACTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	11.30%	1.02%	0.42%	NA
All Indica	2759	98.90%	0.20%	0.83%	0.00%	NA
All Japonica	1512	63.40%	33.90%	1.59%	1.19%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.80%	0.10%	2.08%	0.00%	NA
Indica Intermediate	786	99.00%	0.50%	0.51%	0.00%	NA
Temperate Japonica	767	42.80%	54.60%	2.61%	0.00%	NA
Tropical Japonica	504	91.10%	5.20%	0.40%	3.37%	NA
Japonica Intermediate	241	71.00%	27.80%	0.83%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	16.70%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0135049651	T -> G	LOC_Os01g60620.1	upstream_gene_variant ; 1898.0bp to feature; MODIFIER	silent_mutation	Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688	N	N	N	N
vg0135049651	T -> G	LOC_Os01g60630.1	downstream_gene_variant ; 3167.0bp to feature; MODIFIER	silent_mutation	Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688	N	N	N	N
vg0135049651	T -> G	LOC_Os01g60620-LOC_Os01g60630	intergenic_region ; MODIFIER	silent_mutation	Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688	N	N	N	N
vg0135049651	T -> DEL	N	N	silent_mutation	Average:44.168; most accessible tissue: Zhenshan97 flower, score: 71.688	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0135049651	NA	1.13E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135049651	NA	1.34E-09	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135049651	NA	5.99E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0135049651	NA	7.49E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135049651	3.65E-07	NA	mr1100_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135049651	NA	3.71E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135049651	NA	4.71E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0135049651	NA	3.84E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251