\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131676504:

Variant ID: vg0131676504 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31676504
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, G: 0.29, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGTTGGTGATGTGGCAGCCGTGGGACCTAAAATTGGGTGTAAAATGGCAGAGGAGAGCTGGTTTGTGGGGACCTGGGGTAAATTGTCTAAGTTATTTG[G/T]
GAAGATGGCATTTGGGAATGCTACATCTAAGTGAATGGCAAATAGTCCAAAATCCCGAGGTGGGTGGATAAGGACACATGGGTGGTGCTAAAATATGGAG

Reverse complement sequence

CTCCATATTTTAGCACCACCCATGTGTCCTTATCCACCCACCTCGGGATTTTGGACTATTTGCCATTCACTTAGATGTAGCATTCCCAAATGCCATCTTC[C/A]
CAAATAACTTAGACAATTTACCCCAGGTCCCCACAAACCAGCTCTCCTCTGCCATTTTACACCCAATTTTAGGTCCCACGGCTGCCACATCACCAACCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 14.60% 0.06% 0.00% NA
All Indica  2759 98.20% 1.80% 0.04% 0.00% NA
All Japonica  1512 58.70% 41.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.20% 0.13% 0.00% NA
Temperate Japonica  767 30.90% 69.00% 0.13% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 68.50% 31.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131676504 G -> T LOC_Os01g55090.1 upstream_gene_variant ; 182.0bp to feature; MODIFIER silent_mutation Average:92.693; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0131676504 G -> T LOC_Os01g55090.2 upstream_gene_variant ; 148.0bp to feature; MODIFIER silent_mutation Average:92.693; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0131676504 G -> T LOC_Os01g55094.1 downstream_gene_variant ; 4829.0bp to feature; MODIFIER silent_mutation Average:92.693; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0131676504 G -> T LOC_Os01g55094.2 downstream_gene_variant ; 1807.0bp to feature; MODIFIER silent_mutation Average:92.693; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0131676504 G -> T LOC_Os01g55094.3 downstream_gene_variant ; 4829.0bp to feature; MODIFIER silent_mutation Average:92.693; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N
vg0131676504 G -> T LOC_Os01g55090-LOC_Os01g55094 intergenic_region ; MODIFIER silent_mutation Average:92.693; most accessible tissue: Zhenshan97 panicle, score: 95.903 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0131676504 G T 0.05 0.04 0.05 0.04 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131676504 NA 9.75E-13 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0131676504 NA 5.72E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0131676504 NA 3.06E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0131676504 NA 2.91E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0131676504 NA 9.96E-14 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 1.12E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 5.44E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 5.20E-06 7.87E-26 mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 1.35E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 1.70E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 1.56E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 3.66E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 4.22E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 2.44E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 3.05E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 3.69E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 6.12E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 6.99E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 8.43E-06 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 2.25E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131676504 NA 5.09E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251