\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0123227054:

Variant ID: vg0123227054 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 23227054
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAGTTTTGTTGTGAAGTGAGCTTAGTTTAACTTGGTAGGTTTCTTGTAATAGAACCAGCCTATTTATTTAGGTTCAAGTTCTAGAGTTAACACGAGTA[C/A]
TCGTATTTATAACTAATTATTCTTTTAGTAGTAAGTGAGGCGTCCGTGATAACGAATTCATCAATCTCGAGATGCATAGGGATAGGGAGCATATGTACTG

Reverse complement sequence

CAGTACATATGCTCCCTATCCCTATGCATCTCGAGATTGATGAATTCGTTATCACGGACGCCTCACTTACTACTAAAAGAATAATTAGTTATAAATACGA[G/T]
TACTCGTGTTAACTCTAGAACTTGAACCTAAATAAATAGGCTGGTTCTATTACAAGAAACCTACCAAGTTAAACTAAGCTCACTTCACAACAAAACTGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 41.70% 0.02% 0.00% NA
All Indica  2759 29.80% 70.20% 0.04% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 22.90% 77.10% 0.00% 0.00% NA
Indica II  465 7.70% 92.30% 0.00% 0.00% NA
Indica III  913 44.20% 55.80% 0.00% 0.00% NA
Indica Intermediate  786 31.30% 68.60% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0123227054 C -> A LOC_Os01g41020.1 upstream_gene_variant ; 818.0bp to feature; MODIFIER silent_mutation Average:86.185; most accessible tissue: Callus, score: 92.233 N N N N
vg0123227054 C -> A LOC_Os01g41010.1 downstream_gene_variant ; 404.0bp to feature; MODIFIER silent_mutation Average:86.185; most accessible tissue: Callus, score: 92.233 N N N N
vg0123227054 C -> A LOC_Os01g41010.2 downstream_gene_variant ; 434.0bp to feature; MODIFIER silent_mutation Average:86.185; most accessible tissue: Callus, score: 92.233 N N N N
vg0123227054 C -> A LOC_Os01g41010-LOC_Os01g41020 intergenic_region ; MODIFIER silent_mutation Average:86.185; most accessible tissue: Callus, score: 92.233 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0123227054 C A -0.01 -0.01 -0.02 -0.01 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0123227054 NA 1.35E-22 Yield All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0123227054 NA 4.07E-07 Yield Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0123227054 NA 1.72E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123227054 NA 1.41E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123227054 NA 1.54E-37 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0123227054 NA 1.31E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251