Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0122087924:

Variant ID: vg0122087924 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 22087924
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, C: 0.12, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TATTGATTGTGTGTAAGCTGTTATTTCGTTTCATGTTCCTCAAGTGTGTGGTAAGAAAACATAAGAGAAATCATAACATTGTAGAAGGCACATTTAGACT[C/G]
TGCTTGATATGTGAATTTTTGTATCACATGGCCACACACACGGAAATACTGTTTACATCCTAATAATTTTCAGCTACCTTAGACGTTGGATGGTTATACC

Reverse complement sequence

GGTATAACCATCCAACGTCTAAGGTAGCTGAAAATTATTAGGATGTAAACAGTATTTCCGTGTGTGTGGCCATGTGATACAAAAATTCACATATCAAGCA[G/C]
AGTCTAAATGTGCCTTCTACAATGTTATGATTTCTCTTATGTTTTCTTACCACACACTTGAGGAACATGAAACGAAATAACAGCTTACACACAATCAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 43.30% 0.53% 1.35% NA
All Indica  2759 87.40% 9.50% 0.87% 2.21% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.00% NA
Aus  269 50.60% 48.70% 0.00% 0.74% NA
Indica I  595 96.10% 1.00% 2.86% 0.00% NA
Indica II  465 94.60% 2.40% 0.86% 2.15% NA
Indica III  913 80.20% 17.60% 0.11% 2.08% NA
Indica Intermediate  786 84.90% 10.80% 0.25% 4.07% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 89.60% 0.00% 0.00% NA
Intermediate  90 31.10% 66.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0122087924 C -> G LOC_Os01g39260.1 3_prime_UTR_variant ; 186.0bp to feature; MODIFIER silent_mutation Average:85.909; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N
vg0122087924 C -> G LOC_Os01g39270.1 downstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:85.909; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N
vg0122087924 C -> G LOC_Os01g39280.1 downstream_gene_variant ; 3624.0bp to feature; MODIFIER silent_mutation Average:85.909; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N
vg0122087924 C -> DEL N N silent_mutation Average:85.909; most accessible tissue: Minghui63 flag leaf, score: 93.233 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0122087924 C G 0.02 0.02 0.02 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0122087924 NA 6.43E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0122087924 NA 1.79E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 2.21E-18 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 4.65E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 1.27E-46 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 1.29E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 1.05E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 7.62E-11 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 4.52E-66 mr1671 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 9.50E-22 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 2.40E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 1.10E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 6.93E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 1.39E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 5.39E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 7.44E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 4.04E-27 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 1.13E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 9.95E-91 mr1671_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122087924 NA 6.28E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251