\
| Variant ID: vg0120457787 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 20457787 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )
TCAAAGAGAGCCGAGACTGAGCTTTCGTTTGGCACCCACCCTTGAGGGGCGAGGCCGTTAGGTGTATGTTGTGCCATTCAATGGGAAACATATTGCACGC[T/G]
CCACATGCTCGCGTGCAAATTAACCGCCGGTGCTCATGGGTAAGGGATACCACACAGTACACCGTGATTGTTTTGCCGGTTCATCCAGGAGATGTAGTGC
GCACTACATCTCCTGGATGAACCGGCAAAACAATCACGGTGTACTGTGTGGTATCCCTTACCCATGAGCACCGGCGGTTAATTTGCACGCGAGCATGTGG[A/C]
GCGTGCAATATGTTTCCCATTGAATGGCACAACATACACCTAACGGCCTCGCCCCTCAAGGGTGGGTGCCAAACGAAAGCTCAGTCTCGGCTCTCTTTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 8.50% | 6.92% | 0.17% | NA |
| All Indica | 2759 | 95.60% | 0.90% | 3.44% | 0.04% | NA |
| All Japonica | 1512 | 61.70% | 23.50% | 14.35% | 0.40% | NA |
| Aus | 269 | 95.50% | 0.70% | 3.72% | 0.00% | NA |
| Indica I | 595 | 95.80% | 0.70% | 3.36% | 0.17% | NA |
| Indica II | 465 | 96.80% | 1.70% | 1.51% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.10% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 90.60% | 1.70% | 7.76% | 0.00% | NA |
| Temperate Japonica | 767 | 38.60% | 39.50% | 21.25% | 0.65% | NA |
| Tropical Japonica | 504 | 93.50% | 1.20% | 5.36% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 19.50% | 11.20% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 14.40% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0120457787 | T -> G | LOC_Os01g36780-LOC_Os01g36790 | intergenic_region ; MODIFIER | silent_mutation | Average:79.369; most accessible tissue: Zhenshan97 panicle, score: 86.788 | N | N | N | N |
| vg0120457787 | T -> DEL | N | N | silent_mutation | Average:79.369; most accessible tissue: Zhenshan97 panicle, score: 86.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0120457787 | NA | 2.72E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0120457787 | NA | 1.15E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | NA | 5.23E-07 | mr1013 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | NA | 6.81E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | 1.69E-06 | 8.25E-14 | mr1034 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | NA | 8.49E-06 | mr1034 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | NA | 2.52E-06 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | 5.65E-06 | NA | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | NA | 3.97E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | NA | 9.51E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | 8.69E-06 | 4.36E-08 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | 5.58E-06 | 5.58E-06 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | NA | 1.37E-06 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | NA | 8.69E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0120457787 | NA | 3.99E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |