\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0116329592:

Variant ID: vg0116329592 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 16329592
Reference Allele: TAGAlternative Allele: CAG,T
Primary Allele: CAGSecondary Allele: TAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTATGAAATTAGTTTTCTTATTCGTGTCCGAAAACCCTTTCCGATATCCGGTCAAACGTTCGATGTGACACCCAAAAATTTTCATTTCGTGATCTAAA[TAG/CAG,T]
GCCCGTATTTCACGGTGCCAGATTTGCTTTGCCCCATTTTTGGGATCGATGGATTGAATGGAAGTGAAATGAAAGGGCTTCCGGCCTGTGGGTGGGGCCC

Reverse complement sequence

GGGCCCCACCCACAGGCCGGAAGCCCTTTCATTTCACTTCCATTCAATCCATCGATCCCAAAAATGGGGCAAAGCAAATCTGGCACCGTGAAATACGGGC[CTA/CTG,A]
TTTAGATCACGAAATGAAAATTTTTGGGTGTCACATCGAACGTTTGACCGGATATCGGAAAGGGTTTTCGGACACGAATAAGAAAACTAATTTCATAACT

Allele Frequencies:

Populations Population SizeFrequency of CAG(primary allele) Frequency of TAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 13.70% 1.57% 0.00% T: 0.04%
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 54.00% 41.20% 4.76% 0.00% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 20.90% 71.40% 7.69% 0.00% NA
Tropical Japonica  504 97.20% 1.00% 1.79% 0.00% NA
Japonica Intermediate  241 69.30% 29.00% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 16.70% 1.11% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0116329592 TAG -> T LOC_Os01g29150.1 upstream_gene_variant ; 1219.0bp to feature; MODIFIER silent_mutation Average:88.06; most accessible tissue: Minghui63 panicle, score: 97.557 N N N N
vg0116329592 TAG -> T LOC_Os01g29150-LOC_Os01g29160 intergenic_region ; MODIFIER silent_mutation Average:88.06; most accessible tissue: Minghui63 panicle, score: 97.557 N N N N
vg0116329592 TAG -> CAG LOC_Os01g29150.1 upstream_gene_variant ; 1218.0bp to feature; MODIFIER silent_mutation Average:88.06; most accessible tissue: Minghui63 panicle, score: 97.557 N N N N
vg0116329592 TAG -> CAG LOC_Os01g29150-LOC_Os01g29160 intergenic_region ; MODIFIER silent_mutation Average:88.06; most accessible tissue: Minghui63 panicle, score: 97.557 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0116329592 TAG CAG 0.05 0.05 0.04 0.06 0.06 0.05
vg0116329592 TAG T 0.3 0.26 0.14 -0.17 -0.05 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0116329592 NA 1.38E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0116329592 NA 3.23E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 5.25E-08 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 1.41E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 9.06E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 1.67E-06 3.17E-16 mr1034 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 1.13E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 1.25E-12 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 2.44E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 1.13E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 5.80E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 6.07E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 1.00E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 1.10E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 1.91E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 3.66E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 7.73E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 7.36E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 7.33E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 1.42E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 1.31E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 3.73E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0116329592 NA 3.62E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251