\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113820611:

Variant ID: vg0113820611 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13820611
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GGAACAAAAAATAAACCGAATTCCCTTAATAGGTAGTTTCTAAAATATGTGGGTTTTTTGCAATGGAATGTTTCGTTAACTGCAACATCAGATCTATACA[T/C]
AGTGAAACATTGTGAGTACACAAGGTGAAATATTTTTTGTGGAACAAAAAAATAAACCAAATTCCCTTAATAGAGAGTTTCCAAAATATGTGAGTTTTTT

Reverse complement sequence

AAAAAACTCACATATTTTGGAAACTCTCTATTAAGGGAATTTGGTTTATTTTTTTGTTCCACAAAAAATATTTCACCTTGTGTACTCACAATGTTTCACT[A/G]
TGTATAGATCTGATGTTGCAGTTAACGAAACATTCCATTGCAAAAAACCCACATATTTTAGAAACTACCTATTAAGGGAATTCGGTTTATTTTTTGTTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.00% 17.10% 1.31% 24.59% NA
All Indica  2759 58.00% 2.60% 0.40% 39.00% NA
All Japonica  1512 50.80% 45.80% 3.24% 0.13% NA
Aus  269 90.70% 0.40% 0.00% 8.92% NA
Indica I  595 96.50% 0.50% 0.34% 2.69% NA
Indica II  465 34.40% 2.20% 0.43% 63.01% NA
Indica III  913 43.70% 5.60% 0.22% 50.49% NA
Indica Intermediate  786 59.30% 1.10% 0.64% 38.93% NA
Temperate Japonica  767 27.00% 68.40% 4.43% 0.13% NA
Tropical Japonica  504 82.10% 16.70% 1.19% 0.00% NA
Japonica Intermediate  241 61.00% 34.90% 3.73% 0.41% NA
VI/Aromatic  96 29.20% 24.00% 0.00% 46.88% NA
Intermediate  90 58.90% 22.20% 2.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113820611 T -> DEL N N silent_mutation Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393 N N N N
vg0113820611 T -> C LOC_Os01g24500.1 downstream_gene_variant ; 3547.0bp to feature; MODIFIER silent_mutation Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393 N N N N
vg0113820611 T -> C LOC_Os01g24510.1 downstream_gene_variant ; 2151.0bp to feature; MODIFIER silent_mutation Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393 N N N N
vg0113820611 T -> C LOC_Os01g24520.1 downstream_gene_variant ; 3330.0bp to feature; MODIFIER silent_mutation Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393 N N N N
vg0113820611 T -> C LOC_Os01g24500-LOC_Os01g24510 intergenic_region ; MODIFIER silent_mutation Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113820611 NA 1.84E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113820611 NA 9.20E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113820611 NA 2.50E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 4.17E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 7.44E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 4.47E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 4.52E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 1.16E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 3.07E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 4.13E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 6.91E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 2.88E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 3.57E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 3.04E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 4.79E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 1.06E-06 NA mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 8.80E-08 mr1550 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 8.98E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 4.61E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 7.49E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 9.04E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 9.00E-08 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 1.37E-06 mr1826 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 7.46E-07 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 8.60E-09 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 7.46E-07 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 2.98E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 2.51E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 1.58E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 7.34E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 2.35E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 2.77E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 7.30E-07 mr1492_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 1.55E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 3.28E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 2.31E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 3.22E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 3.23E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611 NA 5.20E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251