Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0113820611:

Variant ID: vg0113820611 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13820611
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GGAACAAAAAATAAACCGAATTCCCTTAATAGGTAGTTTCTAAAATATGTGGGTTTTTTGCAATGGAATGTTTCGTTAACTGCAACATCAGATCTATACA[T/C]
AGTGAAACATTGTGAGTACACAAGGTGAAATATTTTTTGTGGAACAAAAAAATAAACCAAATTCCCTTAATAGAGAGTTTCCAAAATATGTGAGTTTTTT

Reverse complement sequence

AAAAAACTCACATATTTTGGAAACTCTCTATTAAGGGAATTTGGTTTATTTTTTTGTTCCACAAAAAATATTTCACCTTGTGTACTCACAATGTTTCACT[A/G]
TGTATAGATCTGATGTTGCAGTTAACGAAACATTCCATTGCAAAAAACCCACATATTTTAGAAACTACCTATTAAGGGAATTCGGTTTATTTTTTGTTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.00%	17.10%	1.31%	24.59%	NA
All Indica	2759	58.00%	2.60%	0.40%	39.00%	NA
All Japonica	1512	50.80%	45.80%	3.24%	0.13%	NA
Aus	269	90.70%	0.40%	0.00%	8.92%	NA
Indica I	595	96.50%	0.50%	0.34%	2.69%	NA
Indica II	465	34.40%	2.20%	0.43%	63.01%	NA
Indica III	913	43.70%	5.60%	0.22%	50.49%	NA
Indica Intermediate	786	59.30%	1.10%	0.64%	38.93%	NA
Temperate Japonica	767	27.00%	68.40%	4.43%	0.13%	NA
Tropical Japonica	504	82.10%	16.70%	1.19%	0.00%	NA
Japonica Intermediate	241	61.00%	34.90%	3.73%	0.41%	NA
VI/Aromatic	96	29.20%	24.00%	0.00%	46.88%	NA
Intermediate	90	58.90%	22.20%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113820611	T -> DEL	N	N	silent_mutation	Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393	N	N	N	N
vg0113820611	T -> C	LOC_Os01g24500.1	downstream_gene_variant ; 3547.0bp to feature; MODIFIER	silent_mutation	Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393	N	N	N	N
vg0113820611	T -> C	LOC_Os01g24510.1	downstream_gene_variant ; 2151.0bp to feature; MODIFIER	silent_mutation	Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393	N	N	N	N
vg0113820611	T -> C	LOC_Os01g24520.1	downstream_gene_variant ; 3330.0bp to feature; MODIFIER	silent_mutation	Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393	N	N	N	N
vg0113820611	T -> C	LOC_Os01g24500-LOC_Os01g24510	intergenic_region ; MODIFIER	silent_mutation	Average:19.29; most accessible tissue: Zhenshan97 flower, score: 48.393	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113820611	NA	1.84E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113820611	NA	9.20E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113820611	NA	2.50E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	4.17E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	7.44E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	4.47E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	4.52E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	1.16E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	3.07E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	4.13E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	6.91E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	2.88E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	3.57E-09	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	3.04E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	4.79E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	1.06E-06	NA	mr1550	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	8.80E-08	mr1550	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	8.98E-06	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	4.61E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	7.49E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	9.04E-06	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	9.00E-08	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	1.37E-06	mr1826	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	7.46E-07	mr1937	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	8.60E-09	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	7.46E-07	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	2.98E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	2.51E-06	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	1.58E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	7.34E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	2.35E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	2.77E-10	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	7.30E-07	mr1492_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	1.55E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	3.28E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	2.31E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	3.22E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	3.23E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113820611	NA	5.20E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251