\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113511191:

Variant ID: vg0113511191 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13511191
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTTTGCTTTGCACAAGTGTACTGGTCAATGATATATACCACATTTTTACGAAACATGATATTTTTATATAACTAAAAATATAGCCCGCGCACATGCG[T/C]
GGACACTTATTCGATGTGCTTGAAATTTTCGTATTCGATGTGCCTTTTTATTGAAATGATTTTTACTCTATTATAAACATGTTTTTTGTCAAAAATTTAT

Reverse complement sequence

ATAAATTTTTGACAAAAAACATGTTTATAATAGAGTAAAAATCATTTCAATAAAAAGGCACATCGAATACGAAAATTTCAAGCACATCGAATAAGTGTCC[A/G]
CGCATGTGCGCGGGCTATATTTTTAGTTATATAAAAATATCATGTTTCGTAAAAATGTGGTATATATCATTGACCAGTACACTTGTGCAAAGCAAAATTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 38.20% 0.06% 0.00% NA
All Indica  2759 82.20% 17.80% 0.04% 0.00% NA
All Japonica  1512 17.20% 82.70% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 55.10% 44.90% 0.00% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 93.80% 6.20% 0.00% 0.00% NA
Indica Intermediate  786 84.50% 15.40% 0.13% 0.00% NA
Temperate Japonica  767 3.10% 96.70% 0.13% 0.00% NA
Tropical Japonica  504 42.90% 57.10% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.70% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113511191 T -> C LOC_Os01g23990.1 upstream_gene_variant ; 2309.0bp to feature; MODIFIER silent_mutation Average:60.973; most accessible tissue: Callus, score: 75.168 N N N N
vg0113511191 T -> C LOC_Os01g23990-LOC_Os01g24010 intergenic_region ; MODIFIER silent_mutation Average:60.973; most accessible tissue: Callus, score: 75.168 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113511191 NA 1.28E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113511191 NA 2.87E-11 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113511191 NA 6.92E-15 mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113511191 NA 1.26E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113511191 NA 3.41E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113511191 NA 1.11E-10 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113511191 NA 5.96E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113511191 NA 1.06E-07 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113511191 NA 6.34E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113511191 NA 6.15E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113511191 NA 6.62E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251