Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107825906:

Variant ID: vg0107825906 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7825906
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

CCACGACGACAACGCATTGTGACGATTGGCGAGAAGTAAGTAGATGAATTCTTGAATCCCCGCGCTTCTTATTCGCTTATTGTCTGACTCGTGGTCGTCC[C/T]
GTAGGGAGGCGCGAGCAAAGGCTGCGCGAGCCAAGTCCGGAAGAGCTTCTAGTGCGTCGCCCCTTGTGGCCTCGACGGATGTCATGCCCGCAGCCGGGAG

Reverse complement sequence

CTCCCGGCTGCGGGCATGACATCCGTCGAGGCCACAAGGGGCGACGCACTAGAAGCTCTTCCGGACTTGGCTCGCGCAGCCTTTGCTCGCGCCTCCCTAC[G/A]
GGACGACCACGAGTCAGACAATAAGCGAATAAGAAGCGCGGGGATTCAAGAATTCATCTACTTACTTCTCGCCAATCGTCACAATGCGTTGTCGTCGTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.40%	12.80%	7.85%	55.92%	NA
All Indica	2759	3.30%	0.50%	7.50%	88.66%	NA
All Japonica	1512	56.30%	38.20%	2.45%	3.11%	NA
Aus	269	14.50%	0.70%	45.35%	39.41%	NA
Indica I	595	1.70%	0.70%	2.18%	95.46%	NA
Indica II	465	1.30%	0.40%	3.44%	94.84%	NA
Indica III	913	5.50%	0.20%	10.08%	84.23%	NA
Indica Intermediate	786	3.30%	0.80%	10.94%	84.99%	NA
Temperate Japonica	767	25.80%	67.70%	4.30%	2.22%	NA
Tropical Japonica	504	94.00%	1.00%	0.00%	4.96%	NA
Japonica Intermediate	241	74.30%	22.00%	1.66%	2.07%	NA
VI/Aromatic	96	89.60%	5.20%	1.04%	4.17%	NA
Intermediate	90	41.10%	10.00%	4.44%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107825906	C -> T	LOC_Os01g13960.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:13.719; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0107825906	C -> T	LOC_Os01g13970.1	downstream_gene_variant ; 2511.0bp to feature; MODIFIER	silent_mutation	Average:13.719; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg0107825906	C -> DEL	N	N	silent_mutation	Average:13.719; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107825906	NA	2.60E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107825906	NA	1.46E-09	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107825906	NA	4.37E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107825906	NA	4.78E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107825906	NA	1.86E-07	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	3.48E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	2.30E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	1.98E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	4.24E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	3.04E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	2.85E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	9.33E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	3.75E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	4.08E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	1.82E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	NA	1.23E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107825906	3.38E-06	2.84E-07	mr1957_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251