\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107249555:

Variant ID: vg0107249555 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7249555
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTGCATGTAGGAGAGAGTTTAGGAAGAGGTTCAACATCTTGAAAAATTTAGTTGAGTCTAACTCTCATTCAATTCTTGTGTTTTTCCTATGACCTAAT[C/A]
TAACGATCATTCATATATTTCTCCTCTCTTTTTCAATATTTTGTTTTACACTTACATTTCTATCAGAATCATGTGTTTTTTTAATTCTTTTATTTTTTTT

Reverse complement sequence

AAAAAAAATAAAAGAATTAAAAAAACACATGATTCTGATAGAAATGTAAGTGTAAAACAAAATATTGAAAAAGAGAGGAGAAATATATGAATGATCGTTA[G/T]
ATTAGGTCATAGGAAAAACACAAGAATTGAATGAGAGTTAGACTCAACTAAATTTTTCAAGATGTTGAACCTCTTCCTAAACTCTCTCCTACATGCAATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.20% 4.50% 1.33% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 82.30% 13.60% 4.10% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 71.30% 21.30% 7.43% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 81.30% 16.60% 2.07% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107249555 C -> A LOC_Os01g13024.1 upstream_gene_variant ; 3552.0bp to feature; MODIFIER silent_mutation Average:77.521; most accessible tissue: Callus, score: 90.652 N N N N
vg0107249555 C -> A LOC_Os01g13030.1 upstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:77.521; most accessible tissue: Callus, score: 90.652 N N N N
vg0107249555 C -> A LOC_Os01g13030.2 upstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:77.521; most accessible tissue: Callus, score: 90.652 N N N N
vg0107249555 C -> A LOC_Os01g13024-LOC_Os01g13030 intergenic_region ; MODIFIER silent_mutation Average:77.521; most accessible tissue: Callus, score: 90.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107249555 NA 2.79E-18 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107249555 NA 9.99E-10 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107249555 NA 6.73E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107249555 NA 8.04E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107249555 NA 1.69E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 4.23E-11 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 1.06E-06 mr1038_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 8.28E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 5.28E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 3.64E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 4.94E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 1.21E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 3.85E-06 2.50E-14 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 6.03E-09 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 2.07E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 7.76E-08 NA mr1733_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 2.46E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 3.83E-06 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107249555 NA 1.45E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251