\
| Variant ID: vg0107249555 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7249555 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATTGCATGTAGGAGAGAGTTTAGGAAGAGGTTCAACATCTTGAAAAATTTAGTTGAGTCTAACTCTCATTCAATTCTTGTGTTTTTCCTATGACCTAAT[C/A]
TAACGATCATTCATATATTTCTCCTCTCTTTTTCAATATTTTGTTTTACACTTACATTTCTATCAGAATCATGTGTTTTTTTAATTCTTTTATTTTTTTT
AAAAAAAATAAAAGAATTAAAAAAACACATGATTCTGATAGAAATGTAAGTGTAAAACAAAATATTGAAAAAGAGAGGAGAAATATATGAATGATCGTTA[G/T]
ATTAGGTCATAGGAAAAACACAAGAATTGAATGAGAGTTAGACTCAACTAAATTTTTCAAGATGTTGAACCTCTTCCTAAACTCTCTCCTACATGCAATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 4.50% | 1.33% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 82.30% | 13.60% | 4.10% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 71.30% | 21.30% | 7.43% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.30% | 16.60% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107249555 | C -> A | LOC_Os01g13024.1 | upstream_gene_variant ; 3552.0bp to feature; MODIFIER | silent_mutation | Average:77.521; most accessible tissue: Callus, score: 90.652 | N | N | N | N |
| vg0107249555 | C -> A | LOC_Os01g13030.1 | upstream_gene_variant ; 206.0bp to feature; MODIFIER | silent_mutation | Average:77.521; most accessible tissue: Callus, score: 90.652 | N | N | N | N |
| vg0107249555 | C -> A | LOC_Os01g13030.2 | upstream_gene_variant ; 206.0bp to feature; MODIFIER | silent_mutation | Average:77.521; most accessible tissue: Callus, score: 90.652 | N | N | N | N |
| vg0107249555 | C -> A | LOC_Os01g13024-LOC_Os01g13030 | intergenic_region ; MODIFIER | silent_mutation | Average:77.521; most accessible tissue: Callus, score: 90.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107249555 | NA | 2.79E-18 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0107249555 | NA | 9.99E-10 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0107249555 | NA | 6.73E-12 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0107249555 | NA | 8.04E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0107249555 | NA | 1.69E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 4.23E-11 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 1.06E-06 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 8.28E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 5.28E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 3.64E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 4.94E-07 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 1.21E-07 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | 3.85E-06 | 2.50E-14 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 6.03E-09 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 2.07E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | 7.76E-08 | NA | mr1733_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 2.46E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 3.83E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107249555 | NA | 1.45E-09 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |