\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103966667:

Variant ID: vg0103966667 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3966667
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCTAGCTCCATGGATCGACGCCGCCACGCGGACTGCGGCAGGAACCCTCGCTTCGCCGGCCGGCTCCCCGCCGCCGGCCTGAGGAAAAGTTAGGTTTT[T/C]
TTTTTGGAAAAATAATGGATTCTTAAGCCTTCTACTTTTATTTTTTTTCTAATCAAACTTCTTTAAATTAAAAAAATGACAACGCATACAACACCAAATT

Reverse complement sequence

AATTTGGTGTTGTATGCGTTGTCATTTTTTTAATTTAAAGAAGTTTGATTAGAAAAAAAATAAAAGTAGAAGGCTTAAGAATCCATTATTTTTCCAAAAA[A/G]
AAAACCTAACTTTTCCTCAGGCCGGCGGCGGGGAGCCGGCCGGCGAAGCGAGGGTTCCTGCCGCAGTCCGCGTGGCGGCGTCGATCCATGGAGCTAGCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 43.90% 0.25% 0.00% NA
All Indica  2759 29.50% 70.10% 0.40% 0.00% NA
All Japonica  1512 97.20% 2.80% 0.00% 0.00% NA
Aus  269 77.00% 23.00% 0.00% 0.00% NA
Indica I  595 18.20% 81.50% 0.34% 0.00% NA
Indica II  465 9.00% 90.30% 0.65% 0.00% NA
Indica III  913 45.00% 54.50% 0.44% 0.00% NA
Indica Intermediate  786 32.10% 67.70% 0.25% 0.00% NA
Temperate Japonica  767 96.30% 3.70% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103966667 T -> C LOC_Os01g08180.1 upstream_gene_variant ; 3099.0bp to feature; MODIFIER silent_mutation Average:66.364; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0103966667 T -> C LOC_Os01g08170.1 downstream_gene_variant ; 4542.0bp to feature; MODIFIER silent_mutation Average:66.364; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N
vg0103966667 T -> C LOC_Os01g08180-LOC_Os01g08190 intergenic_region ; MODIFIER silent_mutation Average:66.364; most accessible tissue: Minghui63 panicle, score: 86.442 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103966667 T C 0.0 -0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103966667 NA 9.99E-24 Yield All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0103966667 NA 1.27E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103966667 NA 3.20E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103966667 NA 3.23E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103966667 NA 7.82E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103966667 NA 5.49E-16 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251