\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103824036:

Variant ID: vg0103824036 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 3824036
Reference Allele: TAAlternative Allele: T,CA
Primary Allele: TASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACGAACAATTTGGACTACTGTTCATTCAGGTGTTCGCATCATTAGCCATCCCCAGCCTCTGGTAGGATGCAGGAAATACCGTAACATAACAGACAAGA[TA/T,CA]
AAAAAAAATAGTCCATGAGGACATAAGAACTGTTTCTATTAATCCACACATCCAAGAAATCGAGTCTCACCAACTTTAGCAGCGGCATCCTCGCCCTTCT

Reverse complement sequence

AGAAGGGCGAGGATGCCGCTGCTAAAGTTGGTGAGACTCGATTTCTTGGATGTGTGGATTAATAGAAACAGTTCTTATGTCCTCATGGACTATTTTTTTT[TA/A,TG]
TCTTGTCTGTTATGTTACGGTATTTCCTGCATCCTACCAGAGGCTGGGGATGGCTAATGATGCGAACACCTGAATGAACAGTAGTCCAAATTGTTCGTAG

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 1.10% 3.70% 61.24% CA: 0.04%
All Indica  2759 9.70% 0.00% 5.04% 85.18% CA: 0.04%
All Japonica  1512 80.60% 3.40% 0.86% 15.15% NA
Aus  269 8.20% 0.40% 7.06% 84.01% CA: 0.37%
Indica I  595 3.50% 0.00% 8.91% 87.56% NA
Indica II  465 5.40% 0.00% 4.30% 90.32% NA
Indica III  913 15.30% 0.10% 2.74% 81.71% CA: 0.11%
Indica Intermediate  786 10.40% 0.00% 5.22% 84.35% NA
Temperate Japonica  767 87.20% 6.80% 1.43% 4.56% NA
Tropical Japonica  504 68.30% 0.00% 0.40% 31.35% NA
Japonica Intermediate  241 85.10% 0.00% 0.00% 14.94% NA
VI/Aromatic  96 51.00% 0.00% 0.00% 48.96% NA
Intermediate  90 48.90% 0.00% 4.44% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103824036 TA -> T LOC_Os01g07900.1 upstream_gene_variant ; 4255.0bp to feature; MODIFIER silent_mutation Average:82.939; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0103824036 TA -> T LOC_Os01g07920.1 downstream_gene_variant ; 3002.0bp to feature; MODIFIER silent_mutation Average:82.939; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0103824036 TA -> T LOC_Os01g07920.2 downstream_gene_variant ; 3005.0bp to feature; MODIFIER silent_mutation Average:82.939; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0103824036 TA -> T LOC_Os01g07910.1 intron_variant ; MODIFIER silent_mutation Average:82.939; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0103824036 TA -> DEL N N silent_mutation Average:82.939; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0103824036 TA -> CA LOC_Os01g07900.1 upstream_gene_variant ; 4254.0bp to feature; MODIFIER silent_mutation Average:82.939; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0103824036 TA -> CA LOC_Os01g07920.1 downstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:82.939; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0103824036 TA -> CA LOC_Os01g07920.2 downstream_gene_variant ; 3006.0bp to feature; MODIFIER silent_mutation Average:82.939; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0103824036 TA -> CA LOC_Os01g07910.1 intron_variant ; MODIFIER silent_mutation Average:82.939; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103824036 TA CA 0.0 -0.01 -0.01 0.0 0.0 0.0
vg0103824036 TA T 0.07 0.18 0.13 0.1 0.05 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103824036 NA 3.02E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0103824036 4.32E-06 NA mr1973_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251