Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103791160:

Variant ID: vg0103791160 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3791160
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAACACCATGGTATTCACTATTCAGTGCTTACAAAAGGAATCCAGGGTATTTCAGTCACAAAATTTCCGGAAATTCCGAGAAAATTTCCGGAAAGTTTC[T/C]
GATCGATTCCGAGTTCCAACGAAAACTGCCCTTATCATTTTCGATTCCGTTTCTGATAAAATATTTCCGAATTCGTTTCCGTTTCCGAAAAATTCCGACC

Reverse complement sequence

GGTCGGAATTTTTCGGAAACGGAAACGAATTCGGAAATATTTTATCAGAAACGGAATCGAAAATGATAAGGGCAGTTTTCGTTGGAACTCGGAATCGATC[A/G]
GAAACTTTCCGGAAATTTTCTCGGAATTTCCGGAAATTTTGTGACTGAAATACCCTGGATTCCTTTTGTAAGCACTGAATAGTGAATACCATGGTGTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	34.30%	0.06%	0.00%	NA
All Indica	2759	92.10%	7.80%	0.11%	0.00%	NA
All Japonica	1512	13.10%	86.90%	0.00%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	96.10%	3.70%	0.17%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	85.70%	14.20%	0.11%	0.00%	NA
Indica Intermediate	786	92.50%	7.40%	0.13%	0.00%	NA
Temperate Japonica	767	4.60%	95.40%	0.00%	0.00%	NA
Tropical Japonica	504	30.40%	69.60%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103791160	T -> C	LOC_Os01g07860.1	upstream_gene_variant ; 4917.0bp to feature; MODIFIER	silent_mutation	Average:38.314; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N
vg0103791160	T -> C	LOC_Os01g07860-LOC_Os01g07870	intergenic_region ; MODIFIER	silent_mutation	Average:38.314; most accessible tissue: Zhenshan97 flag leaf, score: 54.545	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103791160	NA	9.50E-19	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0103791160	NA	1.28E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	1.75E-17	mr1304	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	7.50E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	1.61E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	4.74E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	3.55E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	2.94E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	1.29E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	4.06E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	1.79E-21	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	3.23E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	1.46E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	NA	1.32E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160	3.74E-06	4.49E-48	mr1670_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251