\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103791160:

Variant ID: vg0103791160 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3791160
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAACACCATGGTATTCACTATTCAGTGCTTACAAAAGGAATCCAGGGTATTTCAGTCACAAAATTTCCGGAAATTCCGAGAAAATTTCCGGAAAGTTTC[T/C]
GATCGATTCCGAGTTCCAACGAAAACTGCCCTTATCATTTTCGATTCCGTTTCTGATAAAATATTTCCGAATTCGTTTCCGTTTCCGAAAAATTCCGACC

Reverse complement sequence

GGTCGGAATTTTTCGGAAACGGAAACGAATTCGGAAATATTTTATCAGAAACGGAATCGAAAATGATAAGGGCAGTTTTCGTTGGAACTCGGAATCGATC[A/G]
GAAACTTTCCGGAAATTTTCTCGGAATTTCCGGAAATTTTGTGACTGAAATACCCTGGATTCCTTTTGTAAGCACTGAATAGTGAATACCATGGTGTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 34.30% 0.06% 0.00% NA
All Indica  2759 92.10% 7.80% 0.11% 0.00% NA
All Japonica  1512 13.10% 86.90% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 96.10% 3.70% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 85.70% 14.20% 0.11% 0.00% NA
Indica Intermediate  786 92.50% 7.40% 0.13% 0.00% NA
Temperate Japonica  767 4.60% 95.40% 0.00% 0.00% NA
Tropical Japonica  504 30.40% 69.60% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103791160 T -> C LOC_Os01g07860.1 upstream_gene_variant ; 4917.0bp to feature; MODIFIER silent_mutation Average:38.314; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N
vg0103791160 T -> C LOC_Os01g07860-LOC_Os01g07870 intergenic_region ; MODIFIER silent_mutation Average:38.314; most accessible tissue: Zhenshan97 flag leaf, score: 54.545 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103791160 NA 9.50E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0103791160 NA 1.28E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 1.75E-17 mr1304 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 7.50E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 1.61E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 4.74E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 3.55E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 2.94E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 1.29E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 4.06E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 1.79E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 3.23E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 1.46E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 NA 1.32E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103791160 3.74E-06 4.49E-48 mr1670_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251