\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103472458:

Variant ID: vg0103472458 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3472458
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAAGACCCTCCTAAGGGGTTATATTCCCTCTTAGGCTACAAAAATTCCCAAATGATCGAGTATCATTTTCGTAAAAAAAAGTATTTTCATTTTCAACT[A/G]
CTCTTGATTTTAGTCATTTTTTTCCATTTTTATCGGTGCAAGTGGTTAGTAAATAATTAAATTGTCAAATATAAGAAATTCATGACCAATCCATAACCAC

Reverse complement sequence

GTGGTTATGGATTGGTCATGAATTTCTTATATTTGACAATTTAATTATTTACTAACCACTTGCACCGATAAAAATGGAAAAAAATGACTAAAATCAAGAG[T/C]
AGTTGAAAATGAAAATACTTTTTTTTACGAAAATGATACTCGATCATTTGGGAATTTTTGTAGCCTAAGAGGGAATATAACCCCTTAGGAGGGTCTTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 31.40% 0.02% 0.00% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 11.00% 88.90% 0.07% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 16.60% 83.40% 0.00% 0.00% NA
Tropical Japonica  504 4.80% 95.20% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 92.90% 0.41% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103472458 A -> G LOC_Os01g07340.1 upstream_gene_variant ; 4938.0bp to feature; MODIFIER silent_mutation Average:72.491; most accessible tissue: Callus, score: 92.4 N N N N
vg0103472458 A -> G LOC_Os01g07350.1 upstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:72.491; most accessible tissue: Callus, score: 92.4 N N N N
vg0103472458 A -> G LOC_Os01g07360.1 downstream_gene_variant ; 1302.0bp to feature; MODIFIER silent_mutation Average:72.491; most accessible tissue: Callus, score: 92.4 N N N N
vg0103472458 A -> G LOC_Os01g07360.3 downstream_gene_variant ; 1302.0bp to feature; MODIFIER silent_mutation Average:72.491; most accessible tissue: Callus, score: 92.4 N N N N
vg0103472458 A -> G LOC_Os01g07360.4 downstream_gene_variant ; 1302.0bp to feature; MODIFIER silent_mutation Average:72.491; most accessible tissue: Callus, score: 92.4 N N N N
vg0103472458 A -> G LOC_Os01g07360.2 downstream_gene_variant ; 1302.0bp to feature; MODIFIER silent_mutation Average:72.491; most accessible tissue: Callus, score: 92.4 N N N N
vg0103472458 A -> G LOC_Os01g07350-LOC_Os01g07360 intergenic_region ; MODIFIER silent_mutation Average:72.491; most accessible tissue: Callus, score: 92.4 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103472458 NA 3.66E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0103472458 NA 3.07E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 2.29E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 9.40E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 8.83E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 1.99E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 4.04E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 6.42E-51 mr1194 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 7.74E-13 mr1205 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 4.26E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 2.05E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 2.92E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 4.34E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 3.46E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 3.18E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 1.85E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 9.36E-22 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 1.43E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 6.89E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 3.55E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 1.12E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 9.70E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 5.19E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 2.34E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 2.98E-23 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 3.73E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 5.92E-39 mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 5.06E-09 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 5.04E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103472458 NA 1.57E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251