\
| Variant ID: vg0102964097 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2964097 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 354. )
ATCACACTGAACCTTCGGATTGGAGTACAGCGTCAGCCAAGACTGCGAGCTGTCCAGCCAAACCTGCTGCTTGTTCCGGCCATCGACGTCGATGAAGTTG[C/A]
GTGTCACCACAGCTTCATTTGACACATTGAACTGGAGATATTCCTCTCTGCTGTTGTCGAAGAACCCAAGGTGAAAGCCAGGTGAATTGCCGATCAGCTC
GAGCTGATCGGCAATTCACCTGGCTTTCACCTTGGGTTCTTCGACAACAGCAGAGAGGAATATCTCCAGTTCAATGTGTCAAATGAAGCTGTGGTGACAC[G/T]
CAACTTCATCGACGTCGATGGCCGGAACAAGCAGCAGGTTTGGCTGGACAGCTCGCAGTCTTGGCTGACGCTGTACTCCAATCCGAAGGTTCAGTGTGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 6.40% | 1.21% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 77.60% | 18.60% | 3.77% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 62.70% | 30.10% | 7.17% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 18.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102964097 | C -> A | LOC_Os01g06240.1 | missense_variant ; p.Arg274Leu; MODERATE | nonsynonymous_codon ; R274L | Average:74.404; most accessible tissue: Zhenshan97 flag leaf, score: 82.17 | possibly damaging |
1.696 |
TOLERATED | 0.50 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102964097 | NA | 2.28E-14 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0102964097 | NA | 6.17E-15 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0102964097 | 3.19E-06 | NA | mr1092 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102964097 | NA | 1.19E-07 | mr1092 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102964097 | NA | 2.31E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102964097 | 4.79E-06 | NA | mr1889 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102964097 | 7.82E-08 | NA | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102964097 | 4.81E-07 | 3.75E-08 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102964097 | 1.05E-06 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102964097 | NA | 1.94E-07 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102964097 | 8.76E-06 | 8.76E-06 | mr1958_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |