Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102115289:

Variant ID: vg0102115289 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 2115289
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAAATAAAATATGTCGCTAAAATGGTGCAACATGAGGTGCAAGAAAGTAAAAGGTGGCAAATCCATTAAAAAATCATCATACGTAGGGATATGTTGTT[A/G]
TACAAACATAACCAAGTTTTTCAGATATGTGGAAAGAAACAAAGCAACTAAAAATAGATTATGAGTTAAAATTTGGTATGTAGGTATTTGACAAAGCAGT

Reverse complement sequence

ACTGCTTTGTCAAATACCTACATACCAAATTTTAACTCATAATCTATTTTTAGTTGCTTTGTTTCTTTCCACATATCTGAAAAACTTGGTTATGTTTGTA[T/C]
AACAACATATCCCTACGTATGATGATTTTTTAATGGATTTGCCACCTTTTACTTTCTTGCACCTCATGTTGCACCATTTTAGCGACATATTTTATTTTAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	28.20%	0.02%	0.21%	NA
All Indica	2759	77.40%	22.20%	0.04%	0.36%	NA
All Japonica	1512	65.40%	34.60%	0.00%	0.00%	NA
Aus	269	44.60%	55.40%	0.00%	0.00%	NA
Indica I	595	33.30%	66.20%	0.17%	0.34%	NA
Indica II	465	95.30%	4.50%	0.00%	0.22%	NA
Indica III	913	92.10%	7.80%	0.00%	0.11%	NA
Indica Intermediate	786	83.10%	16.20%	0.00%	0.76%	NA
Temperate Japonica	767	48.90%	51.10%	0.00%	0.00%	NA
Tropical Japonica	504	96.80%	3.20%	0.00%	0.00%	NA
Japonica Intermediate	241	52.30%	47.70%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	31.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0102115289	A -> G	LOC_Os01g04699.1	upstream_gene_variant ; 3638.0bp to feature; MODIFIER	silent_mutation	Average:44.36; most accessible tissue: Callus, score: 84.939	N	N	N	N
vg0102115289	A -> G	LOC_Os01g04699-LOC_Os01g04710	intergenic_region ; MODIFIER	silent_mutation	Average:44.36; most accessible tissue: Callus, score: 84.939	N	N	N	N
vg0102115289	A -> DEL	N	N	silent_mutation	Average:44.36; most accessible tissue: Callus, score: 84.939	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0102115289	NA	3.68E-12	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102115289	NA	7.35E-12	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102115289	NA	6.15E-08	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	7.72E-06	9.46E-08	mr1406	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	5.69E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	1.81E-09	mr1089_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	1.20E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	1.60E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	5.27E-06	mr1204_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	9.70E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	3.44E-12	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	2.12E-07	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	1.61E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	6.55E-07	mr1406_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	2.76E-09	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	1.23E-10	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	5.32E-06	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102115289	NA	4.34E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251