\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102113172:

Variant ID: vg0102113172 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2113172
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCTTGTTTAGTACCAAAATAATTTTTCAAACTTCTAACTTTTCTATCACATTAAAACTTTTCTACACACATAAACTTCCAAATTTTCTATCACATCGTT[C/T]
CAATTTAAATCAAATTTTTAATTTTAGTGTGAACTAAAACACAACTGTAATCGAGTGAGGCCTGAGAATGTCTGCGTGATAATGCTCAGACTGGAGTACT

Reverse complement sequence

AGTACTCCAGTCTGAGCATTATCACGCAGACATTCTCAGGCCTCACTCGATTACAGTTGTGTTTTAGTTCACACTAAAATTAAAAATTTGATTTAAATTG[G/A]
AACGATGTGATAGAAAATTTGGAAGTTTATGTGTGTAGAAAAGTTTTAATGTGATAGAAAAGTTAGAAGTTTGAAAAATTATTTTGGTACTAAACAAGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 28.10% 0.15% 6.18% NA
All Indica  2759 73.80% 24.10% 0.14% 1.96% NA
All Japonica  1512 54.60% 39.40% 0.13% 5.82% NA
Aus  269 36.40% 8.20% 0.37% 55.02% NA
Indica I  595 32.80% 66.60% 0.34% 0.34% NA
Indica II  465 95.10% 4.50% 0.00% 0.43% NA
Indica III  913 86.00% 10.00% 0.11% 3.94% NA
Indica Intermediate  786 78.10% 20.00% 0.13% 1.78% NA
Temperate Japonica  767 44.20% 53.30% 0.00% 2.48% NA
Tropical Japonica  504 84.10% 12.30% 0.20% 3.37% NA
Japonica Intermediate  241 26.10% 51.90% 0.41% 21.58% NA
VI/Aromatic  96 67.70% 30.20% 0.00% 2.08% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102113172 C -> T LOC_Os01g04690.1 upstream_gene_variant ; 3537.0bp to feature; MODIFIER silent_mutation Average:58.065; most accessible tissue: Minghui63 root, score: 87.892 N N N N
vg0102113172 C -> T LOC_Os01g04699.1 upstream_gene_variant ; 1521.0bp to feature; MODIFIER silent_mutation Average:58.065; most accessible tissue: Minghui63 root, score: 87.892 N N N N
vg0102113172 C -> T LOC_Os01g04699-LOC_Os01g04710 intergenic_region ; MODIFIER silent_mutation Average:58.065; most accessible tissue: Minghui63 root, score: 87.892 N N N N
vg0102113172 C -> DEL N N silent_mutation Average:58.065; most accessible tissue: Minghui63 root, score: 87.892 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0102113172 C T 0.02 0.0 -0.01 0.0 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102113172 NA 1.74E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102113172 NA 1.71E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0102113172 3.07E-06 3.07E-06 mr1074_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113172 NA 1.71E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113172 NA 7.66E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113172 NA 5.01E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102113172 NA 8.27E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251