\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101329012:

Variant ID: vg0101329012 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1329012
Reference Allele: AAlternative Allele: T,C
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGGCGACGTCCTGTCCGGCCGCTCGCTGTCGCTCGTCAGCGTCGGCCCTCCGCCGACGGCGAACTGCGAGCTGCTGTACAAGATTGAACTCGCCGCCG[A/T,C]
CGGGCCAGGACCGTGCACGGGCGTGCTTAAGCTGTCGGCGTCTGGCACTGTCCCGTGCGTCCGCCGGCTGGAGGGGTTCAATGCGAAGGCGTTCCTCTTC

Reverse complement sequence

GAAGAGGAACGCCTTCGCATTGAACCCCTCCAGCCGGCGGACGCACGGGACAGTGCCAGACGCCGACAGCTTAAGCACGCCCGTGCACGGTCCTGGCCCG[T/A,G]
CGGCGGCGAGTTCAATCTTGTACAGCAGCTCGCAGTTCGCCGTCGGCGGAGGGCCGACGCTGACGAGCGACAGCGAGCGGCCGGACAGGACGTCGCCGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 5.50% 1.16% 21.50% C: 0.19%
All Indica  2759 67.30% 6.00% 0.91% 25.41% C: 0.33%
All Japonica  1512 89.40% 0.70% 1.39% 8.60% NA
Aus  269 11.50% 27.90% 1.12% 59.48% NA
Indica I  595 72.60% 4.20% 1.51% 21.68% NA
Indica II  465 94.80% 1.10% 0.43% 3.66% NA
Indica III  913 51.90% 10.30% 0.99% 36.14% C: 0.66%
Indica Intermediate  786 65.00% 5.30% 0.64% 28.63% C: 0.38%
Temperate Japonica  767 85.40% 0.90% 2.61% 11.08% NA
Tropical Japonica  504 97.20% 0.60% 0.20% 1.98% NA
Japonica Intermediate  241 85.50% 0.00% 0.00% 14.52% NA
VI/Aromatic  96 79.20% 4.20% 2.08% 14.58% NA
Intermediate  90 75.60% 7.80% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101329012 A -> T LOC_Os01g03270.1 missense_variant ; p.Asp238Val; MODERATE nonsynonymous_codon ; D238V Average:79.598; most accessible tissue: Zhenshan97 panicle, score: 90.268 possibly damaging -1.737 TOLERATED 0.29
vg0101329012 A -> DEL LOC_Os01g03270.1 N frameshift_variant Average:79.598; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0101329012 A -> C LOC_Os01g03270.1 missense_variant ; p.Asp238Ala; MODERATE nonsynonymous_codon ; D238A Average:79.598; most accessible tissue: Zhenshan97 panicle, score: 90.268 possibly damaging -1.885 TOLERATED 0.75

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101329012 NA 1.00E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 1.80E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 7.08E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 8.56E-06 8.56E-06 mr1381 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 3.84E-07 3.85E-07 mr1462 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 6.58E-06 6.58E-06 mr1462 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 4.14E-06 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 7.94E-06 7.92E-06 mr1572 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 3.52E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 6.93E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 8.85E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 4.79E-06 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 9.61E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 4.30E-06 4.31E-06 mr1899 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 6.52E-06 6.52E-06 mr1957 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 8.81E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329012 NA 2.18E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251