\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101329001:

Variant ID: vg0101329001 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1329001
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTGCTCAACGGCGGCGACGTCCTGTCCGGCCGCTCGCTGTCGCTCGTCAGCGTCGGCCCTCCGCCGACGGCGAACTGCGAGCTGCTGTACAAGATTGA[A/G]
CTCGCCGCCGACGGGCCAGGACCGTGCACGGGCGTGCTTAAGCTGTCGGCGTCTGGCACTGTCCCGTGCGTCCGCCGGCTGGAGGGGTTCAATGCGAAGG

Reverse complement sequence

CCTTCGCATTGAACCCCTCCAGCCGGCGGACGCACGGGACAGTGCCAGACGCCGACAGCTTAAGCACGCCCGTGCACGGTCCTGGCCCGTCGGCGGCGAG[T/C]
TCAATCTTGTACAGCAGCTCGCAGTTCGCCGTCGGCGGAGGGCCGACGCTGACGAGCGACAGCGAGCGGCCGGACAGGACGTCGCCGCCGTTGAGCAGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 6.20% 0.99% 21.35% NA
All Indica  2759 67.20% 7.00% 0.58% 25.30% NA
All Japonica  1512 89.40% 0.80% 1.59% 8.27% NA
Aus  269 10.40% 29.00% 0.74% 59.85% NA
Indica I  595 71.90% 5.20% 1.18% 21.68% NA
Indica II  465 94.80% 1.10% 0.43% 3.66% NA
Indica III  913 51.80% 11.50% 0.44% 36.25% NA
Indica Intermediate  786 65.00% 6.50% 0.38% 28.12% NA
Temperate Japonica  767 85.10% 1.20% 2.48% 11.21% NA
Tropical Japonica  504 97.20% 0.60% 0.40% 1.79% NA
Japonica Intermediate  241 86.30% 0.00% 1.24% 12.45% NA
VI/Aromatic  96 79.20% 5.20% 1.04% 14.58% NA
Intermediate  90 75.60% 7.80% 4.44% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101329001 A -> G LOC_Os01g03270.1 synonymous_variant ; p.Glu234Glu; LOW synonymous_codon Average:80.333; most accessible tissue: Zhenshan97 panicle, score: 90.849 N N N N
vg0101329001 A -> DEL LOC_Os01g03270.1 N frameshift_variant Average:80.333; most accessible tissue: Zhenshan97 panicle, score: 90.849 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101329001 NA 1.32E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 1.59E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 7.08E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 3.63E-06 3.63E-06 mr1381 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 3.43E-07 3.43E-07 mr1462 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 6.58E-06 6.58E-06 mr1462 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 1.40E-06 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 7.05E-06 7.03E-06 mr1572 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 3.52E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 4.03E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 8.85E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 4.79E-06 mr1728 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 9.61E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 3.35E-06 3.36E-06 mr1899 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 4.72E-06 mr1923 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 5.98E-06 5.99E-06 mr1957 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 6.14E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 7.37E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 4.43E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101329001 NA 1.27E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251