\
| Variant ID: vg0101329001 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 1329001 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCCTGCTCAACGGCGGCGACGTCCTGTCCGGCCGCTCGCTGTCGCTCGTCAGCGTCGGCCCTCCGCCGACGGCGAACTGCGAGCTGCTGTACAAGATTGA[A/G]
CTCGCCGCCGACGGGCCAGGACCGTGCACGGGCGTGCTTAAGCTGTCGGCGTCTGGCACTGTCCCGTGCGTCCGCCGGCTGGAGGGGTTCAATGCGAAGG
CCTTCGCATTGAACCCCTCCAGCCGGCGGACGCACGGGACAGTGCCAGACGCCGACAGCTTAAGCACGCCCGTGCACGGTCCTGGCCCGTCGGCGGCGAG[T/C]
TCAATCTTGTACAGCAGCTCGCAGTTCGCCGTCGGCGGAGGGCCGACGCTGACGAGCGACAGCGAGCGGCCGGACAGGACGTCGCCGCCGTTGAGCAGGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.40% | 6.20% | 0.99% | 21.35% | NA |
| All Indica | 2759 | 67.20% | 7.00% | 0.58% | 25.30% | NA |
| All Japonica | 1512 | 89.40% | 0.80% | 1.59% | 8.27% | NA |
| Aus | 269 | 10.40% | 29.00% | 0.74% | 59.85% | NA |
| Indica I | 595 | 71.90% | 5.20% | 1.18% | 21.68% | NA |
| Indica II | 465 | 94.80% | 1.10% | 0.43% | 3.66% | NA |
| Indica III | 913 | 51.80% | 11.50% | 0.44% | 36.25% | NA |
| Indica Intermediate | 786 | 65.00% | 6.50% | 0.38% | 28.12% | NA |
| Temperate Japonica | 767 | 85.10% | 1.20% | 2.48% | 11.21% | NA |
| Tropical Japonica | 504 | 97.20% | 0.60% | 0.40% | 1.79% | NA |
| Japonica Intermediate | 241 | 86.30% | 0.00% | 1.24% | 12.45% | NA |
| VI/Aromatic | 96 | 79.20% | 5.20% | 1.04% | 14.58% | NA |
| Intermediate | 90 | 75.60% | 7.80% | 4.44% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0101329001 | A -> G | LOC_Os01g03270.1 | synonymous_variant ; p.Glu234Glu; LOW | synonymous_codon | Average:80.333; most accessible tissue: Zhenshan97 panicle, score: 90.849 | N | N | N | N |
| vg0101329001 | A -> DEL | LOC_Os01g03270.1 | N | frameshift_variant | Average:80.333; most accessible tissue: Zhenshan97 panicle, score: 90.849 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0101329001 | NA | 1.32E-14 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 1.59E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 7.08E-06 | mr1358 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | 3.63E-06 | 3.63E-06 | mr1381 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | 3.43E-07 | 3.43E-07 | mr1462 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | 6.58E-06 | 6.58E-06 | mr1462 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 1.40E-06 | mr1500 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | 7.05E-06 | 7.03E-06 | mr1572 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 3.52E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 4.03E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 8.85E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 4.79E-06 | mr1728 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 9.61E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | 3.35E-06 | 3.36E-06 | mr1899 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 4.72E-06 | mr1923 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | 5.98E-06 | 5.99E-06 | mr1957 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 6.14E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 7.37E-06 | mr1355_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 4.43E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101329001 | NA | 1.27E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |