Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101055689:

Variant ID: vg0101055689 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 1055689
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTACAAATTTAGTAAAAAAAATTATCACAAAACTATAGGTTTAGTGTCAATTCAATCACAAAACTTAGACGTTTATAACTCAAATATAACACTAATGC[T/C]
AAAGATTTAAACTCCAAAATCTGTAGTTTTGTGATAACTTTGTTACTAAATCTATAGTTTTGTGATACTCCACCTTAAAATTGTAATTTTGTGATAAATT

Reverse complement sequence

AATTTATCACAAAATTACAATTTTAAGGTGGAGTATCACAAAACTATAGATTTAGTAACAAAGTTATCACAAAACTACAGATTTTGGAGTTTAAATCTTT[A/G]
GCATTAGTGTTATATTTGAGTTATAAACGTCTAAGTTTTGTGATTGAATTGACACTAAACCTATAGTTTTGTGATAATTTTTTTTACTAAATTTGTAGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	9.00%	0.04%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	75.30%	24.50%	0.13%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	64.10%	35.60%	0.26%	0.00%	NA
Tropical Japonica	504	92.30%	7.70%	0.00%	0.00%	NA
Japonica Intermediate	241	75.50%	24.50%	0.00%	0.00%	NA
VI/Aromatic	96	67.70%	32.30%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0101055689	T -> C	LOC_Os01g02890.1	downstream_gene_variant ; 2523.0bp to feature; MODIFIER	silent_mutation	Average:49.12; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0101055689	T -> C	LOC_Os01g02900.1	downstream_gene_variant ; 1448.0bp to feature; MODIFIER	silent_mutation	Average:49.12; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0101055689	T -> C	LOC_Os01g02900.2	downstream_gene_variant ; 1448.0bp to feature; MODIFIER	silent_mutation	Average:49.12; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N
vg0101055689	T -> C	LOC_Os01g02890-LOC_Os01g02900	intergenic_region ; MODIFIER	silent_mutation	Average:49.12; most accessible tissue: Zhenshan97 root, score: 62.394	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0101055689	8.02E-07	NA	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0101055689	NA	8.49E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0101055689	NA	4.73E-11	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0101055689	1.01E-06	NA	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	6.97E-10	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	1.82E-09	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	3.82E-07	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	4.28E-06	4.28E-06	mr1952	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	9.62E-06	mr1045_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	1.63E-06	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	6.24E-11	5.89E-09	mr1354_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	2.10E-06	2.30E-12	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	3.73E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	4.40E-07	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	2.73E-07	mr1568_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	6.43E-06	mr1621_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	4.05E-09	1.43E-15	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	8.21E-11	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	7.59E-07	1.23E-18	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689	NA	3.59E-10	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251