\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101055689:

Variant ID: vg0101055689 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1055689
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTACAAATTTAGTAAAAAAAATTATCACAAAACTATAGGTTTAGTGTCAATTCAATCACAAAACTTAGACGTTTATAACTCAAATATAACACTAATGC[T/C]
AAAGATTTAAACTCCAAAATCTGTAGTTTTGTGATAACTTTGTTACTAAATCTATAGTTTTGTGATACTCCACCTTAAAATTGTAATTTTGTGATAAATT

Reverse complement sequence

AATTTATCACAAAATTACAATTTTAAGGTGGAGTATCACAAAACTATAGATTTAGTAACAAAGTTATCACAAAACTACAGATTTTGGAGTTTAAATCTTT[A/G]
GCATTAGTGTTATATTTGAGTTATAAACGTCTAAGTTTTGTGATTGAATTGACACTAAACCTATAGTTTTGTGATAATTTTTTTTACTAAATTTGTAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 9.00% 0.04% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 75.30% 24.50% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 64.10% 35.60% 0.26% 0.00% NA
Tropical Japonica  504 92.30% 7.70% 0.00% 0.00% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101055689 T -> C LOC_Os01g02890.1 downstream_gene_variant ; 2523.0bp to feature; MODIFIER silent_mutation Average:49.12; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0101055689 T -> C LOC_Os01g02900.1 downstream_gene_variant ; 1448.0bp to feature; MODIFIER silent_mutation Average:49.12; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0101055689 T -> C LOC_Os01g02900.2 downstream_gene_variant ; 1448.0bp to feature; MODIFIER silent_mutation Average:49.12; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N
vg0101055689 T -> C LOC_Os01g02890-LOC_Os01g02900 intergenic_region ; MODIFIER silent_mutation Average:49.12; most accessible tissue: Zhenshan97 root, score: 62.394 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101055689 8.02E-07 NA Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0101055689 NA 8.49E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0101055689 NA 4.73E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0101055689 1.01E-06 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 6.97E-10 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 1.82E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 3.82E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 4.28E-06 4.28E-06 mr1952 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 9.62E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 1.63E-06 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 6.24E-11 5.89E-09 mr1354_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 2.10E-06 2.30E-12 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 3.73E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 4.40E-07 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 2.73E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 6.43E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 4.05E-09 1.43E-15 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 8.21E-11 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 7.59E-07 1.23E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101055689 NA 3.59E-10 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251