RiceVarMap2

Search for Variation by Gene:

Search Results:

303 variations found. Os11g0685400/LOC_Os11g45820 (expressed protein), ranging from 27,723,835 bp to 27,726,283 bp (including 0 kb upstream and 0 kb downstream of the gene).

Gene ID	Annotation
LOC_Os11g45820	expressed protein; RAP ID: Os11g0685400; MSU ID: LOC_Os11g45820

Gene Expression Atlas:

The expression data is from the CREP database. And the expression value is log2-transformed. Move the mouse over the cells of the heat map to get detailed tissue information and expression values.

Variation Map (with Chromatin Accessibility Map/ Non-coding Varation Scores Map) in Searched Region:

The 'big effect' variations are marked out:

Color	Explain	Details
red	High impact variants defined by snpEff	'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff.
purple	'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2	This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here.

Detailed Variation Information:

Show entries

Excel CSV

Search:

Var ID	Chrom	Position	Primary Allele	Secondary Allele	Primary Allele Frequency	DEL Frequency	Var	GWAS Results	Effect
vg1127723835 (J)	chr11	27723835	T	TGGG	64.20%	28.04%	T -> TGG,G,TGGG ,TGC	NA	LOC_Os11g45820.1 Alt: TGG\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: TGG\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: TGGG\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: TGGG\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: TGC\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: TGC\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: G\| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: G\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809-LOC_Os11g45820 Alt: G\| intergenic_region MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 39.027; most accessible tissue: Callus, score: 90.438
vg1127723838 (J)	chr11	27723838	G	C	71.60%	27.44%	G -> C	NA	N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: C\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: C\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 37.806; most accessible tissue: Callus, score: 90.438
vg1127723842 (J)	chr11	27723842	G	A	71.50%	27.30%	G -> A	NA	LOC_Os11g45820.1 Alt: A\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: A\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 38.412; most accessible tissue: Callus, score: 90.438
vg1127723850 (J)	chr11	27723850	T	A	71.90%	27.40%	T -> A	NA	LOC_Os11g45820.1 Alt: A\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: A\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 38.420; most accessible tissue: Callus, score: 90.438
vg1127723865 (J)	chr11	27723865	C	G	55.50%	28.04%	C -> G	mr1133 (Ind_All); LR P-value: 4.69E-08; mr1667 (Ind_All); LR P-value: 3.31E-06; mr1133_2 (All); LMM P-value: 3.41E-06; mr1133_2 (Ind_All); LR P-value: 2.47E-08; mr1667_2 (Ind_All); LR P-value: 9.05E-07	N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: G\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: G\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 39.458; most accessible tissue: Callus, score: 90.438
vg1127723883 (J)	chr11	27723883	C	T	70.10%	27.51%	C -> T	NA	LOC_Os11g45820.1 Alt: T\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: T\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 40.097; most accessible tissue: Callus, score: 90.438
vg1127723898 (J)	chr11	27723898	TGAACAG AACTTGT GGAATGG GTGGATG GGCATAA AGACAAT GATTTTG ACCAAAC GCAGAGG GGAAAAT ATCGGAC TTTG	T	70.60%	27.32%	TGAACAGAAC TTGTGGAATG GGTGGATGGG CATAAAGACA ATGATTTTGA CCAAACGCAG AGGGGAAAAT ATCGGACTTT G -> T	NA	LOC_Os11g45820.1 Alt: T\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: T\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 40.826; most accessible tissue: Callus, score: 90.438
vg1127723912 (J)	chr11	27723912	T	G	67.20%	28.25%	G -> T	NA	LOC_Os11g45820.1 Alt: T\| 5_prime_UTR_premature_start_codon_gain_variant LOW(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: T\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: T\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 41.278; most accessible tissue: Callus, score: 90.438
vg1127723916 (J)	chr11	27723916	T	C	70.70%	27.27%	T -> C	NA	N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: C\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: C\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 40.857; most accessible tissue: Callus, score: 90.438
vg1127723921 (J)	chr11	27723921	G	A	42.10%	28.21%	G -> A	NA	LOC_Os11g45820.1 Alt: A\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: A\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 41.555; most accessible tissue: Callus, score: 90.438
vg1127723928 (J)	chr11	27723928	C	T	71.50%	27.25%	C -> T	NA	LOC_Os11g45820.1 Alt: T\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: T\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 42.733; most accessible tissue: Callus, score: 95.085
vg1127723968 (J)	chr11	27723968	A	G	42.50%	28.10%	A -> G	NA	N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: G\| 5_prime_UTR_premature_start_codon_gain_variant LOW(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: G\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: G\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 43.749; most accessible tissue: Callus, score: 95.085
vg1127724045 (J)	chr11	27724045	C	CCATTTT TTTTGAG AA	72.40%	25.77%	C -> CCATTTTTT, CCATTTTTTT TGAGAATTAA TATTATTTTT ATGGAAAA,C CATTTTTTTT GAGAATTAAT ATTATT,CCA TTTTTTTTGA GAA,CCA,CG A	NA	LOC_Os11g45820.1 Alt: CCATTTTTT\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: CCATTTTTT\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: CCATTTTTTTTGAGAA\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: CCATTTTTTTTGAGAA\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: CCA\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: CCA\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: CGA\| 5_prime_UTR_variant MODIFIER(snpEff) LOC_Os11g45809.1 Alt: CGA\| downstream_gene_variant MODIFIER(snpEff) LOC_Os11g45820.1 Alt: CCATTTTTTTTGAGAATTAATATTATT\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: CCATTTTTTTTGAGAATTAATATTATT\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: CCATTTTTTTTGAGAATTAATATTATTTTTATGGAAAA\| 5_prime_UTR_variant MODIFIER(snpEff) LOC_Os11g45809.1 Alt: CCATTTTTTTTGAGAATTAATATTATTTTTATGGAAAA\| downstream_gene_variant MODIFIER(snpEff) The average chromatin accessibility score: 50.905; most accessible tissue: Callus, score: 95.085
vg1127724083 (J)	chr11	27724083	T	A	63.80%	28.97%	T -> A	NA	LOC_Os11g45820.1 Alt: A\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: A\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 51.074; most accessible tissue: Minghui63 panicle, score: 85.556
vg1127724097 (J)	chr11	27724097	T	TAAGAGA G	72.30%	27.19%	T -> TAAGAGAG	NA	N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: TAAGAGAG\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: TAAGAGAG\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 51.427; most accessible tissue: Minghui63 panicle, score: 84.552
vg1127724099 (J)	chr11	27724099	A	AGAGAGA ATCCACT CAGTACC AC	71.40%	27.42%	A -> AGAGAGAATC CACTCAG,AG AGAGAATCCA CTCAGTACCA C,AGAGAGAA TCCACTCAGT ACCACTGAGT T,AGAGAGAA TCCACTCAGT ACCACTGAGT TTTCCCCACT ,AGAGAGAAT CCACTCAGTA CCACTGAGTT TTCCCCAC,A GAGAGAATCC ACTCAGTACC ACTGAGTTT	NA	LOC_Os11g45820.1 Alt: AGAGAGAATCCACTCAGTACCACTGAGTTTTCCCCAC\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: AGAGAGAATCCACTCAGTACCACTGAGTTTTCCCCAC\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: AGAGAGAATCCACTCAGTACCACTGAGTT\| 5_prime_UTR_variant MODIFIER(snpEff) LOC_Os11g45809.1 Alt: AGAGAGAATCCACTCAGTACCACTGAGTT\| downstream_gene_variant MODIFIER(snpEff) LOC_Os11g45820.1 Alt: AGAGAGAATCCACTCAGTACCACTGAGTTT\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: AGAGAGAATCCACTCAGTACCACTGAGTTT\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: AGAGAGAATCCACTCAG\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: AGAGAGAATCCACTCAG\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: AGAGAGAATCCACTCAGTACCACTGAGTTTTCCCCACT\| 5_prime_UTR_variant MODIFIER(snpEff) LOC_Os11g45809.1 Alt: AGAGAGAATCCACTCAGTACCACTGAGTTTTCCCCACT\| downstream_gene_variant MODIFIER(snpEff) LOC_Os11g45820.1 Alt: AGAGAGAATCCACTCAGTACCAC\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: AGAGAGAATCCACTCAGTACCAC\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 51.342; most accessible tissue: Minghui63 panicle, score: 84.552
vg1127724101 (J)	chr11	27724101	G	C	70.70%	28.29%	G -> A,C,GAGTTT T,GAGTTTTC	NA	LOC_Os11g45820.1 Alt: A\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: A\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: GAGTTTT\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: GAGTTTT\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: C\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: C\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: GAGTTTTC\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: GAGTTTTC\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 51.342; most accessible tissue: Minghui63 panicle, score: 84.552
vg1127724103 (J)	chr11	27724103	C	CACTGAG	71.40%	28.02%	C -> CACTGAG,A	NA	LOC_Os11g45820.1 Alt: CACTGAG\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: CACTGAG\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: A\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: A\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 51.293; most accessible tissue: Minghui63 panicle, score: 84.552
vg1127724104 (J)	chr11	27724104	T	C	71.40%	27.53%	T -> C	NA	N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: C\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: C\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 51.235; most accessible tissue: Minghui63 panicle, score: 84.552
vg1127724153 (J)	chr11	27724153	T	A	70.50%	26.89%	T -> A	NA	LOC_Os11g45820.1 Alt: A\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: A\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 52.352; most accessible tissue: Minghui63 panicle, score: 85.556
vg1127724202 (J)	chr11	27724202	C	T	77.40%	19.66%	C -> T	NA	LOC_Os11g45820.1 Alt: T\| 5_prime_UTR_premature_start_codon_gain_variant LOW(snpEff)/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: T\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: T\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 55.242; most accessible tissue: Callus, score: 90.002
vg1127724222 (J)	chr11	27724222	A	T	72.80%	22.32%	A -> T	NA	LOC_Os11g45820.1 Alt: T\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: T\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 56.729; most accessible tissue: Callus, score: 90.002
vg1127724232 (J)	chr11	27724232	A	C	72.30%	25.98%	A -> C	NA	N Alt: DEL/silent_mutation(CooVar) LOC_Os11g45820.1 Alt: C\| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os11g45809.1 Alt: C\| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 56.718; most accessible tissue: Callus, score: 90.002
vg1127724256 (J)	chr11	27724256	A	G	73.60%	25.07%	A -> G	NA	LOC_Os11g45820.1 Alt: DEL/frameshift_variant(CooVar) LOC_Os11g45820.1 Alt: G\| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) The average chromatin accessibility score: 56.999; most accessible tissue: Callus, score: 90.002
vg1127724259 (J)	chr11	27724259	G	T	73.60%	25.03%	G -> T	NA	LOC_Os11g45820.1 Alt: T\| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) LOC_Os11g45820.1 Alt: DEL/frameshift_variant(CooVar) The average chromatin accessibility score: 57.073; most accessible tissue: Callus, score: 90.002

Showing 1 to 25 of 303 entries

Previous1 2 3 4 5…13Next

Gene ID/Symbol/Name (e.g., LOC_Os01g08570 or hwh1 or Os01g0180900 or gly%ltransferase, note: wildcard character '%' is also acceptable.):
Upstream (kb, optional, must <= 10 kb) :	Downstream (kb, optional, must <= 10 kb) :
Variations Type: All SNP Only INDEL Only STR Only
Optional: (The selected data will be displayed in the result page.)
Show Gene Expression Atlas	Show Chromatin Accessibility Map
Show Non-coding variation Scores

Search for Variation by Gene:

Optional: (The selected data will be displayed in the result page.)

Search Results:

Gene Expression Atlas:

Variation Map (with Chromatin Accessibility Map/ Non-coding Varation Scores Map) in Searched Region:

The 'big effect' variations are marked out:

Detailed Variation Information:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact