RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1127723865:

Variant ID: vg1127723865 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27723865
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAAAAGTTTGTAACTAAACTTGGCCTAGGTTGTTTTTTTTGGATGGCGTAGGTTGTTTTTTTTTTTTTTATGGAGGGAGTACGTCACATTAAAGTGCC[C/G]
AACAGCTGCTCAAATGTCCCCGTCGTCTATTCTGAACAGAACTTGTGGAATGGGTGGATGGGCATAAAGACAATGATTTTGACCAAACGCAGAGGGGAAA

Reverse complement sequence

TTTCCCCTCTGCGTTTGGTCAAAATCATTGTCTTTATGCCCATCCACCCATTCCACAAGTTCTGTTCAGAATAGACGACGGGGACATTTGAGCAGCTGTT[G/C]
GGCACTTTAATGTGACGTACTCCCTCCATAAAAAAAAAAAAAACAACCTACGCCATCCAAAAAAAACAACCTAGGCCAAGTTTAGTTACAAACTTTTTCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	15.80%	0.68%	28.04%	NA
All Indica	2759	49.80%	22.50%	0.76%	26.86%	NA
All Japonica	1512	71.80%	7.10%	0.33%	20.77%	NA
Aus	269	27.90%	0.40%	1.49%	70.26%	NA
Indica I	595	55.10%	5.20%	2.18%	37.48%	NA
Indica II	465	60.90%	6.90%	0.43%	31.83%	NA
Indica III	913	40.50%	45.70%	0.22%	13.58%	NA
Indica Intermediate	786	50.10%	18.10%	0.51%	31.30%	NA
Temperate Japonica	767	80.80%	1.20%	0.39%	17.60%	NA
Tropical Japonica	504	52.80%	18.10%	0.40%	28.77%	NA
Japonica Intermediate	241	82.60%	3.30%	0.00%	14.11%	NA
VI/Aromatic	96	31.20%	2.10%	2.08%	64.58%	NA
Intermediate	90	62.20%	16.70%	0.00%	21.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127723865	C -> DEL	N	N	silent_mutation	Average:39.458; most accessible tissue: Callus, score: 90.438	N	N	N	N
vg1127723865	C -> G	LOC_Os11g45820.1	5_prime_UTR_variant ; 379.0bp to feature; MODIFIER	silent_mutation	Average:39.458; most accessible tissue: Callus, score: 90.438	N	N	N	N
vg1127723865	C -> G	LOC_Os11g45809.1	downstream_gene_variant ; 2765.0bp to feature; MODIFIER	silent_mutation	Average:39.458; most accessible tissue: Callus, score: 90.438	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127723865	NA	4.69E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127723865	NA	3.31E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127723865	3.41E-06	NA	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127723865	NA	2.47E-08	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127723865	NA	9.05E-07	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1127723865:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact