21 variations found. Os05g0537100/LOC_Os05g46020 (WRKY7; expressed), ranging from 26,682,471 bp to 26,684,208 bp (including 0 kb upstream and 0 kb downstream of the gene).
| Gene ID | Annotation |
|---|---|
| LOC_Os05g46020 | OsWRKY7 - Superfamily of TFs having WRKY and zinc finger domains, expressed; RAP ID: Os05g0537100; MSU ID: LOC_Os05g46020 |
| MSU ID | RAP ID | Symbol | Name | Explanation | Recommended Gene Symbol | Recommended Gene Name |
|---|---|---|---|---|---|---|
| LOC_Os05g46020 | Os05g0537100 | OsWRKY7 | Rice WRKY gene7 | BK005010. DQ298179. WRKY46 in Zhang and Wang (2005) and in Berri et al. (2009). WRKY57 in Wu et al (2007). | WRKY7 | WRKY GENE 7 |
The expression data is from the CREP database. And the expression value is log2-transformed. Move the mouse over the cells of the heat map to get detailed tissue information and expression values.
| Color | Explain | Details |
|---|---|---|
| red | High impact variants defined by snpEff | 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff. |
| purple | 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 | This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here. |
| Var ID | Chrom | Position | Primary Allele | Secondary Allele | Primary Allele Frequency | DEL Frequency | Var | GWAS Results | Effect |
|---|---|---|---|---|---|---|---|---|---|
| vg0526682587 (J) | chr05 | 26682587 | C | T | 62.10% | 0.30% | T -> C |
mr1022 (Ind_All); LR P-value: 4.68E-12;
mr1059 (All); LR P-value: 2.64E-15; mr1141 (All); LR P-value: 2.05E-46; mr1167 (All); LR P-value: 7.97E-16; mr1178 (Ind_All); LR P-value: 1.66E-12; mr1675 (All); LR P-value: 7.85E-15; mr1726 (All); LR P-value: 8.34E-14; mr1903 (All); LR P-value: 3.02E-26; mr1903 (Ind_All); LR P-value: 3.34E-08; mr1934 (Ind_All); LR P-value: 9.22E-09; mr1969 (All); LR P-value: 2.52E-14; mr1995 (All); LR P-value: 2.82E-16; mr1030_2 (All); LR P-value: 2.51E-07; mr1039_2 (Ind_All); LR P-value: 2.21E-07; mr1141_2 (All); LR P-value: 3.12E-60; mr1141_2 (Ind_All); LR P-value: 2.58E-09; mr1193_2 (Ind_All); LR P-value: 6.60E-06; mr1195_2 (All); LR P-value: 7.69E-20; mr1195_2 (Ind_All); LR P-value: 5.32E-10; mr1332_2 (Ind_All); LR P-value: 6.86E-06; mr1352_2 (Ind_All); LR P-value: 2.69E-11; mr1358_2 (All); LR P-value: 7.81E-07; mr1546_2 (All); LR P-value: 5.54E-48; mr1546_2 (Ind_All); LR P-value: 3.04E-13; mr1682_2 (Ind_All); LR P-value: 1.76E-06; mr1828_2 (All); LMM P-value: 1.44E-06; LR P-value: 4.45E-70; mr1828_2 (Ind_All); LR P-value: 3.43E-09; mr1837_2 (All); LR P-value: 9.87E-08; mr1889_2 (Ind_All); LR P-value: 6.68E-08; mr1893_2 (All); LR P-value: 1.01E-10; mr1907_2 (Ind_All); LR P-value: 5.84E-10; mr1934_2 (Ind_All); LR P-value: 7.50E-09; mr1938_2 (All); LR P-value: 2.79E-14 |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os05g46020.1 Alt: C| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 97.653; most accessible tissue: Zhenshan97 flag leaf, score: 99.646 |
| vg0526682761 (J) | chr05 | 26682761 | C | A | 99.00% | 0.00% | C -> A | NA |
LOC_Os05g46020.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 96.798; most accessible tissue: Zhenshan97 flag leaf, score: 99.091 |
| vg0526682971 (J) | chr05 | 26682971 | A | G | 55.60% | 0.28% | G -> A |
mr1032 (Ind_All); LR P-value: 9.35E-06;
mr1253 (All); LR P-value: 7.75E-20; mr1255 (All); LR P-value: 3.08E-18; mr1610 (All); LR P-value: 9.09E-09; mr1896 (Ind_All); LR P-value: 4.58E-08; mr1903 (Ind_All); LR P-value: 7.21E-09; mr1907 (Ind_All); LR P-value: 3.39E-10; mr1934 (Ind_All); LR P-value: 8.78E-10; mr1938 (All); LR P-value: 2.23E-11; mr1109_2 (All); LR P-value: 1.75E-55; mr1253_2 (All); LR P-value: 3.32E-25; mr1332_2 (Ind_All); LR P-value: 3.19E-06; mr1352_2 (Ind_All); LR P-value: 1.73E-10; mr1358_2 (All); LR P-value: 7.25E-07; mr1428_2 (Ind_All); LR P-value: 7.29E-06; mr1546_2 (Ind_All); LR P-value: 1.94E-10; mr1682_2 (Ind_All); LR P-value: 2.44E-06; mr1828_2 (Ind_All); LR P-value: 4.38E-09; mr1907_2 (Ind_All); LR P-value: 2.77E-09; mr1934_2 (Ind_All); LR P-value: 2.43E-09; mr1938_2 (All); LR P-value: 6.21E-14 |
LOC_Os05g46020.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os05g46020.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar) The average chromatin accessibility score: 94.180; most accessible tissue: Minghui63 flower, score: 98.472 |
| vg0526682978 (J) | chr05 | 26682978 | A | G | 55.60% | 0.28% | G -> A |
mr1032 (Ind_All); LR P-value: 9.35E-06;
mr1253 (All); LR P-value: 2.98E-19; mr1255 (All); LR P-value: 1.37E-17; mr1610 (All); LR P-value: 1.35E-08; mr1896 (Ind_All); LR P-value: 4.58E-08; mr1903 (Ind_All); LR P-value: 7.21E-09; mr1907 (Ind_All); LR P-value: 3.39E-10; mr1934 (Ind_All); LR P-value: 8.78E-10; mr1938 (All); LR P-value: 2.28E-11; mr1253_2 (All); LR P-value: 7.96E-25; mr1332_2 (Ind_All); LR P-value: 3.19E-06; mr1349_2 (All); LR P-value: 6.77E-10; mr1352_2 (Ind_All); LR P-value: 1.73E-10; mr1358_2 (All); LR P-value: 4.02E-07; mr1428_2 (Ind_All); LR P-value: 7.29E-06; mr1478_2 (All); LR P-value: 1.39E-08; mr1546_2 (Ind_All); LR P-value: 1.94E-10; mr1598_2 (All); LR P-value: 6.54E-32; mr1682_2 (Ind_All); LR P-value: 2.44E-06; mr1828_2 (Ind_All); LR P-value: 4.38E-09; mr1907_2 (Ind_All); LR P-value: 2.77E-09; mr1934_2 (Ind_All); LR P-value: 2.43E-09; mr1938_2 (All); LR P-value: 7.16E-14 |
LOC_Os05g46020.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os05g46020.1 Alt: A| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar) The average chromatin accessibility score: 93.580; most accessible tissue: Minghui63 flower, score: 98.194 |
| vg0526683371 (J) | chr05 | 26683371 | C | T | 62.10% | 0.32% | T -> C |
mr1022 (Ind_All); LR P-value: 4.68E-12;
mr1059 (All); LR P-value: 2.32E-15; mr1141 (All); LR P-value: 3.96E-46; mr1143 (All); LR P-value: 2.98E-15; mr1167 (All); LR P-value: 5.21E-16; mr1178 (Ind_All); LR P-value: 1.66E-12; mr1675 (All); LR P-value: 6.04E-15; mr1726 (All); LR P-value: 6.05E-14; mr1903 (All); LR P-value: 7.05E-26; mr1903 (Ind_All); LR P-value: 3.34E-08; mr1934 (Ind_All); LR P-value: 9.22E-09; mr1969 (All); LR P-value: 1.87E-14; mr1995 (All); LR P-value: 1.10E-16; mr1030_2 (All); LR P-value: 1.25E-07; mr1039_2 (Ind_All); LR P-value: 2.21E-07; mr1141_2 (All); LR P-value: 2.50E-60; mr1141_2 (Ind_All); LR P-value: 2.58E-09; mr1193_2 (Ind_All); LR P-value: 6.60E-06; mr1195_2 (All); LR P-value: 3.76E-20; mr1195_2 (Ind_All); LR P-value: 5.32E-10; mr1332_2 (Ind_All); LR P-value: 6.86E-06; mr1352_2 (Ind_All); LR P-value: 2.69E-11; mr1358_2 (All); LR P-value: 3.40E-07; mr1408_2 (All); LR P-value: 3.74E-07; mr1546_2 (All); LR P-value: 7.02E-48; mr1546_2 (Ind_All); LR P-value: 3.04E-13; mr1682_2 (Ind_All); LR P-value: 1.76E-06; mr1828_2 (All); LMM P-value: 5.59E-07; LR P-value: 2.84E-70; mr1828_2 (Ind_All); LR P-value: 3.43E-09; mr1837_2 (All); LR P-value: 4.85E-08; mr1889_2 (Ind_All); LR P-value: 6.68E-08; mr1893_2 (All); LR P-value: 7.57E-11; mr1907_2 (Ind_All); LR P-value: 5.84E-10; mr1934_2 (Ind_All); LR P-value: 7.50E-09; mr1938_2 (All); LR P-value: 1.08E-14 |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os05g46030.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 90.470; most accessible tissue: Minghui63 flag leaf, score: 98.453 |
| vg0526683391 (J) | chr05 | 26683391 | C | CCGT | 96.00% | 0.00% | C -> CCGT | NA |
LOC_Os05g46030.1 Alt: CCGT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os05g46020.1 Alt: CCGT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 90.879; most accessible tissue: Minghui63 flag leaf, score: 98.618 |
| vg0526683406 (J) | chr05 | 26683406 | C | T | 55.60% | 0.23% | T -> C |
mr1253 (All); LR P-value: 1.19E-19;
mr1255 (All); LR P-value: 1.72E-18; mr1610 (All); LR P-value: 8.91E-09; mr1938 (All); LR P-value: 5.30E-12; mr1039_2 (Ind_All); LR P-value: 3.21E-07; mr1253_2 (All); LR P-value: 1.46E-24; mr1349_2 (All); LR P-value: 1.22E-09; mr1352_2 (Ind_All); LR P-value: 3.43E-10; mr1358_2 (All); LR P-value: 1.08E-06; mr1478_2 (All); LR P-value: 1.22E-08; mr1546_2 (Ind_All); LR P-value: 4.22E-12; mr1682_2 (Ind_All); LR P-value: 3.61E-06; mr1828_2 (Ind_All); LR P-value: 1.75E-08 |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os05g46030.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 90.965; most accessible tissue: Zhenshan97 flag leaf, score: 98.620 |
| vg0526683473 (J) | chr05 | 26683473 | CTA | C | 99.60% | 0.00% | CTA -> C | NA |
LOC_Os05g46030.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)
LOC_Os05g46020.1 Alt: C| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 94.041; most accessible tissue: Zhenshan97 flag leaf, score: 98.890 |
| vg0526683476 (J) | chr05 | 26683476 | T | TGGCTGT GTTCGTT CCAGTGA C | 78.70% | 8.08% | T -> TGGCTGTGTT CGTTCCAGTG ACATTGGGTG AG,TGGCTGT GTTCGTTCCA GTGAC,TGG, TGGCTGTGTT CGTTCC,TGG CTGTGTTCGT TCCAGTGACA TTGGGTGAGA A,TGGCTGTG TTCGTTCCAG TGACATTGGG TGAGA | NA |
LOC_Os05g46030.1 Alt: TGGCTGTGTTCGTTCC| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os05g46020.1 Alt: TGGCTGTGTTCGTTCC| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: TGGCTGTGTTCGTTCCAGTGAC| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: TGGCTGTGTTCGTTCCAGTGAC| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: TGGCTGTGTTCGTTCCAGTGACATTGGGTGAGA| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: TGGCTGTGTTCGTTCCAGTGACATTGGGTGAGA| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: TGGCTGTGTTCGTTCCAGTGACATTGGGTGAG| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: TGGCTGTGTTCGTTCCAGTGACATTGGGTGAG| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: TGG| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: TGG| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: TGGCTGTGTTCGTTCCAGTGACATTGGGTGAGAA| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: TGGCTGTGTTCGTTCCAGTGACATTGGGTGAGAA| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 94.053; most accessible tissue: Zhenshan97 flag leaf, score: 98.892 |
| vg0526683477 (J) | chr05 | 26683477 | A | C | 88.40% | 4.61% | A -> C,AGTGACAT ,G | NA |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os05g46030.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: AGTGACAT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: AGTGACAT| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: C| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 94.174; most accessible tissue: Zhenshan97 flag leaf, score: 98.921 |
| vg0526683478 (J) | chr05 | 26683478 | T | TTGG | 82.80% | 7.68% | T -> TTGGGTGAGA AAG,TTGG | NA |
LOC_Os05g46030.1 Alt: TTGGGTGAGAAAG| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os05g46020.1 Alt: TTGGGTGAGAAAG| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: TTGG| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: TTGG| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 94.169; most accessible tissue: Zhenshan97 flag leaf, score: 98.911 |
| vg0526683479 (J) | chr05 | 26683479 | G | GGC | 92.80% | 3.03% | G -> GGC | NA |
LOC_Os05g46030.1 Alt: GGC| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os05g46020.1 Alt: GGC| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) N Alt: DEL/silent_mutation(CooVar) The average chromatin accessibility score: 94.180; most accessible tissue: Zhenshan97 flag leaf, score: 98.911 |
| vg0526683480 (J) | chr05 | 26683480 | T | TGA | 94.00% | 2.12% | T -> TGTTCGTTCC AGTGACATTG ,TGA,G | NA |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os05g46030.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: TGA| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: TGA| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: TGTTCGTTCCAGTGACATTG| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46020.1 Alt: TGTTCGTTCCAGTGACATTG| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 94.190; most accessible tissue: Zhenshan97 flag leaf, score: 98.912 |
| vg0526683481 (J) | chr05 | 26683481 | G | GAGAAAG GTC | 99.50% | 0.00% | G -> GTT,GAGAAA GGTC | NA |
LOC_Os05g46030.1 Alt: GTT| upstream_gene_variant MODIFIER(snpEff)
LOC_Os05g46020.1 Alt: GTT| intron_variant MODIFIER(snpEff) LOC_Os05g46030.1 Alt: GAGAAAGGTC| upstream_gene_variant MODIFIER(snpEff) LOC_Os05g46020.1 Alt: GAGAAAGGTC| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 94.190; most accessible tissue: Zhenshan97 flag leaf, score: 98.914 |
| vg0526683482 (J) | chr05 | 26683482 | CAA | AAA | 99.40% | 0.00% | CAA -> AAA,C | NA |
LOC_Os05g46030.1 Alt: AAA| upstream_gene_variant MODIFIER(snpEff)
LOC_Os05g46020.1 Alt: AAA| intron_variant MODIFIER(snpEff) LOC_Os05g46030.1 Alt: C| upstream_gene_variant MODIFIER(snpEff) LOC_Os05g46020.1 Alt: C| intron_variant MODIFIER(snpEff) The average chromatin accessibility score: 94.209; most accessible tissue: Zhenshan97 flag leaf, score: 98.924 |
| vg0526683518 (J) | chr05 | 26683518 | A | G | 99.90% | 0.00% | A -> G | NA |
LOC_Os05g46030.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os05g46020.1 Alt: G| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 93.844; most accessible tissue: Zhenshan97 flag leaf, score: 98.799 |
| vg0526683800 (J) | chr05 | 26683800 | C | T | 62.00% | 0.34% | T -> C |
mr1059 (All); LR P-value: 3.16E-15;
mr1141 (All); LR P-value: 3.50E-46; mr1167 (All); LR P-value: 1.06E-15; mr1675 (All); LR P-value: 1.09E-14; mr1726 (All); LR P-value: 8.37E-14; mr1896 (Ind_All); LR P-value: 2.65E-08; mr1903 (All); LR P-value: 2.46E-26; mr1903 (Ind_All); LR P-value: 8.25E-09; mr1907 (Ind_All); LR P-value: 2.08E-10; mr1934 (Ind_All); LR P-value: 1.97E-09; mr1039_2 (Ind_All); LR P-value: 2.22E-07; mr1141_2 (All); LR P-value: 3.08E-60; mr1141_2 (Ind_All); LR P-value: 2.15E-09; mr1175_2 (All); LR P-value: 3.46E-21; mr1193_2 (Ind_All); LR P-value: 7.35E-06; mr1195_2 (All); LR P-value: 1.18E-19; mr1195_2 (Ind_All); LR P-value: 7.19E-10; mr1332_2 (Ind_All); LR P-value: 2.65E-06; mr1352_2 (Ind_All); LR P-value: 5.00E-11; mr1358_2 (All); LR P-value: 1.66E-06; mr1428_2 (Ind_All); LR P-value: 8.63E-06; mr1546_2 (All); LR P-value: 4.92E-47; mr1546_2 (Ind_All); LR P-value: 5.30E-12; mr1682_2 (Ind_All); LR P-value: 1.09E-06; mr1828_2 (All); LMM P-value: 2.51E-06; LR P-value: 1.09E-69; mr1828_2 (Ind_All); LMM P-value: 9.76E-06; LR P-value: 2.65E-09; mr1837_2 (All); LR P-value: 1.38E-07; mr1889_2 (Ind_All); LR P-value: 1.36E-08; mr1893_2 (All); LR P-value: 1.31E-10; mr1896_2 (Ind_All); LR P-value: 3.11E-06; mr1907_2 (Ind_All); LR P-value: 7.37E-11; mr1934_2 (Ind_All); LR P-value: 6.36E-10; mr1938_2 (All); LR P-value: 3.48E-14 |
N Alt: DEL/silent_mutation(CooVar)
LOC_Os05g46020.1 Alt: C| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar) LOC_Os05g46030.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 96.173; most accessible tissue: Zhenshan97 flag leaf, score: 98.634 |
| vg0526683815 (J) | chr05 | 26683815 | GCTA | G | 94.80% | 0.00% | GCTA -> G | NA |
LOC_Os05g46020.1 Alt: G| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os05g46030.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 96.128; most accessible tissue: Zhenshan97 flag leaf, score: 98.537 |
| vg0526684063 (J) | chr05 | 26684063 | A | G | 94.80% | 0.00% | A -> G |
mr1098 (All); LR P-value: 8.98E-32;
mr1099 (All); LR P-value: 1.16E-26; mr1101 (All); LR P-value: 3.05E-29; mr1113 (All); LR P-value: 8.62E-17; mr1114 (All); LR P-value: 8.38E-21; mr1116 (All); LR P-value: 7.55E-18; mr1117 (All); LR P-value: 2.09E-21; mr1119 (All); LR P-value: 1.47E-17; mr1120 (All); LR P-value: 9.32E-22; mr1123 (All); LR P-value: 1.90E-26; mr1180 (All); LR P-value: 1.88E-10; mr1240 (All); LR P-value: 8.98E-18; mr1247 (All); LR P-value: 3.19E-24; mr1496 (All); LR P-value: 1.19E-14; mr1589 (All); LR P-value: 6.13E-22; mr1858 (All); LR P-value: 5.86E-26; mr1859 (All); LR P-value: 5.46E-26; mr1868 (All); LR P-value: 1.22E-25; mr1897 (All); LR P-value: 5.45E-12; mr1911 (All); LR P-value: 4.14E-17; mr1918 (All); LR P-value: 9.35E-13; mr1936 (All); LR P-value: 1.98E-19; mr1961 (All); LR P-value: 2.41E-19; mr1095_2 (All); LR P-value: 9.30E-21; mr1098_2 (All); LR P-value: 4.28E-35; mr1099_2 (All); LR P-value: 3.86E-28; mr1113_2 (All); LR P-value: 4.82E-21; mr1114_2 (All); LR P-value: 3.59E-20; mr1117_2 (All); LR P-value: 1.41E-23; mr1119_2 (All); LR P-value: 5.45E-22; mr1120_2 (All); LR P-value: 1.64E-27; mr1123_2 (All); LR P-value: 3.35E-30; mr1240_2 (All); LR P-value: 1.21E-21; mr1247_2 (All); LR P-value: 7.85E-31; mr1496_2 (All); LR P-value: 1.67E-16; mr1911_2 (All); LR P-value: 2.03E-15; mr1918_2 (All); LR P-value: 3.98E-14; mr1929_2 (All); LR P-value: 5.57E-06; mr1936_2 (All); LR P-value: 2.29E-18; mr1961_2 (All); LR P-value: 4.87E-17 |
LOC_Os05g46020.1 Alt: G| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os05g46030.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 93.455; most accessible tissue: Minghui63 flower, score: 96.073 |
| vg0526684179 (J) | chr05 | 26684179 | T | C | 62.10% | 0.00% | C -> T |
mr1022 (Ind_All); LR P-value: 4.68E-12;
mr1059 (All); LR P-value: 1.75E-15; mr1141 (All); LR P-value: 2.95E-47; mr1143 (All); LR P-value: 3.08E-15; mr1167 (All); LR P-value: 4.04E-16; mr1178 (Ind_All); LR P-value: 1.66E-12; mr1675 (All); LR P-value: 3.80E-15; mr1726 (All); LR P-value: 5.87E-14; mr1903 (All); LR P-value: 8.30E-27; mr1903 (Ind_All); LR P-value: 3.34E-08; mr1934 (Ind_All); LR P-value: 9.22E-09; mr1969 (All); LR P-value: 1.22E-14; mr1995 (All); LR P-value: 1.53E-16; mr1030_2 (All); LR P-value: 2.00E-07; mr1039_2 (Ind_All); LR P-value: 2.21E-07; mr1141_2 (All); LR P-value: 7.65E-61; mr1141_2 (Ind_All); LR P-value: 2.58E-09; mr1193_2 (Ind_All); LR P-value: 6.60E-06; mr1195_2 (All); LR P-value: 5.11E-20; mr1195_2 (Ind_All); LR P-value: 5.32E-10; mr1332_2 (Ind_All); LR P-value: 6.86E-06; mr1352_2 (Ind_All); LR P-value: 2.69E-11; mr1358_2 (All); LR P-value: 4.92E-07; mr1546_2 (All); LR P-value: 1.85E-48; mr1546_2 (Ind_All); LR P-value: 3.04E-13; mr1682_2 (Ind_All); LR P-value: 1.76E-06; mr1828_2 (All); LMM P-value: 7.79E-07; LR P-value: 6.75E-71; mr1828_2 (Ind_All); LR P-value: 3.43E-09; mr1837_2 (All); LR P-value: 8.03E-08; mr1889_2 (Ind_All); LR P-value: 6.68E-08; mr1893_2 (All); LR P-value: 4.41E-11; mr1907_2 (Ind_All); LR P-value: 5.84E-10; mr1934_2 (Ind_All); LR P-value: 7.50E-09; mr1938_2 (All); LR P-value: 2.67E-14 |
LOC_Os05g46020.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os05g46030.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar) The average chromatin accessibility score: 87.166; most accessible tissue: Zhenshan97 flag leaf, score: 92.587 |
| STR0526683815 (J) | chr05 | 26683815 | GCTAGCT AGCTA | GCTAGCT AG | 98.20% | 0.00% | GCTAGCTAGC TA -> GCTAGCTAG | NA |
|