Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0526682587:

Variant ID: vg0526682587 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 26682587
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CGAACCTTCTCCCTCCTCACGAAGCTCACCGCGAAGCCGGCAAAATCCTCCCGGAGAGAGAGACACAAACACAACACAACCAGCTCCCCCGCGCCCCGCG[T/C]
GCGATCGATCACGATCGATCTCATCCCTCTCGATCGCCTACTACTACCAGTACAAATCCACCCCGCCACCACTACATCATCCCCTCATATCCATGCAGAT

Reverse complement sequence

ATCTGCATGGATATGAGGGGATGATGTAGTGGTGGCGGGGTGGATTTGTACTGGTAGTAGTAGGCGATCGAGAGGGATGAGATCGATCGTGATCGATCGC[A/G]
CGCGGGGCGCGGGGGAGCTGGTTGTGTTGTGTTTGTGTCTCTCTCTCCGGGAGGATTTTGCCGGCTTCGCGGTGAGCTTCGTGAGGAGGGAGAAGGTTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.50% 0.11% 0.30% NA
All Indica  2759 92.00% 7.60% 0.14% 0.29% NA
All Japonica  1512 1.10% 98.70% 0.07% 0.13% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 66.50% 32.30% 0.43% 0.86% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 92.50% 7.00% 0.00% 0.51% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.20% 0.00% NA
Japonica Intermediate  241 0.80% 98.30% 0.00% 0.83% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 46.70% 48.90% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0526682587 T -> DEL N N silent_mutation Average:97.653; most accessible tissue: Zhenshan97 flag leaf, score: 99.646 N N N N
vg0526682587 T -> C LOC_Os05g46020.1 5_prime_UTR_variant ; 154.0bp to feature; MODIFIER silent_mutation Average:97.653; most accessible tissue: Zhenshan97 flag leaf, score: 99.646 N N N N
vg0526682587 T -> C LOC_Os05g46030.1 upstream_gene_variant ; 3392.0bp to feature; MODIFIER silent_mutation Average:97.653; most accessible tissue: Zhenshan97 flag leaf, score: 99.646 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0526682587 T C -0.04 -0.01 0.0 -0.04 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0526682587 NA 4.68E-12 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 2.64E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 2.05E-46 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 7.97E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 1.66E-12 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 7.85E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 8.34E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 3.02E-26 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 3.34E-08 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 9.22E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 2.52E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 2.82E-16 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 2.51E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 2.21E-07 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 3.12E-60 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 2.58E-09 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 6.60E-06 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 7.69E-20 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 5.32E-10 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 6.86E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 2.69E-11 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 7.81E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 5.54E-48 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 3.04E-13 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 1.76E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 1.44E-06 4.45E-70 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 3.43E-09 mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 9.87E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 6.68E-08 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 1.01E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 5.84E-10 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 7.50E-09 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0526682587 NA 2.79E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251