Search for Variation by Gene:

Gene ID/Symbol/Name (e.g., LOC_Os01g08570 or hwh1 or Os01g0180900 or gly%ltransferase, note: wildcard character '%' is also acceptable.):
Upstream (kb, optional, must <= 10 kb) : Downstream (kb, optional, must <= 10 kb) :
Variations Type:

Optional: (The selected data will be displayed in the result page.)
 Show Gene Expression Atlas  Show Chromatin Accessibility Map
 Show Non-coding variation Scores

Search Results:

36 variations found. Os02g0225900/LOC_Os02g13260 (F-box family protein; putative; expressed), ranging from 7,062,836 bp to 7,064,444 bp (including 0 kb upstream and 0 kb downstream of the gene).

Gene IDAnnotation
LOC_Os02g13260 F-box family protein, putative, expressed; RAP ID: Os02g0225900; MSU ID: LOC_Os02g13260

Gene Expression Atlas:

The expression data is from the CREP database. And the expression value is log2-transformed. Move the mouse over the cells of the heat map to get detailed tissue information and expression values.

Variation Map (with Chromatin Accessibility Map/ Non-coding Varation Scores Map) in Searched Region:

The 'big effect' variations are marked out:

ColorExplainDetails
red High impact variants defined by snpEff 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff.
purple 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here.

Detailed Variation Information:

Var ID Chrom Position Primary Allele Secondary Allele Primary Allele Frequency DEL Frequency Var GWAS Results Effect
vg0207062837 (J) chr02 7062837 C T 65.60% 0.00% C -> T
mr1091 (Jap_All); LR P-value: 2.00E-06;
mr1137 (Jap_All); LR P-value: 1.46E-09;
mr1229 (All); LR P-value: 2.04E-06;
mr1486 (Jap_All); LR P-value: 2.19E-11;
mr1617 (Jap_All); LR P-value: 1.83E-08;
mr1010_2 (Jap_All); LR P-value: 9.13E-08;
mr1063_2 (Jap_All); LR P-value: 4.26E-06;
mr1161_2 (Jap_All); LR P-value: 2.71E-07;
mr1229_2 (Jap_All); LR P-value: 3.49E-07;
mr1865_2 (Jap_All); LR P-value: 5.44E-06;
mr1880_2 (Jap_All); LR P-value: 2.26E-07
LOC_Os02g13260.1 Alt: T| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 97.594; most accessible tissue: Minghui63 root, score: 99.115
vg0207062853 (J) chr02 7062853 T C 95.80% 0.00% T -> C
mr1053_2 (Ind_All); LR P-value: 2.34E-06;
mr1128_2 (Ind_All); LR P-value: 7.08E-06
LOC_Os02g13260.1 Alt: C| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 97.622; most accessible tissue: Minghui63 root, score: 99.104
vg0207062901 (J) chr02 7062901 A T 52.50% 0.00% T -> A NA
LOC_Os02g13260.1 Alt: A| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 97.654; most accessible tissue: Minghui63 root, score: 99.021
vg0207062914 (J) chr02 7062914 C T 95.80% 0.00% C -> T
mr1053_2 (Ind_All); LR P-value: 2.34E-06;
mr1128_2 (Ind_All); LR P-value: 7.08E-06
LOC_Os02g13260.1 Alt: T| 5_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 97.591; most accessible tissue: Minghui63 root, score: 98.984
vg0207063067 (J) chr02 7063067 G A 99.80% 0.00% G -> A NA
LOC_Os02g13260.1 Alt: A| synonymous_variant LOW(snpEff)
LOC_Os02g13250.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)
LOC_Os02g13270.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)
The average chromatin accessibility score: 96.193; most accessible tissue: Callus, score: 97.452
vg0207063160 (J) chr02 7063160 C T 87.60% 0.00% T -> C
mr1137 (All); LMM P-value: 4.58E-06; LR P-value: 5.88E-33;
mr1137 (Jap_All); LR P-value: 8.00E-11;
mr1486 (Jap_All); LR P-value: 1.18E-09;
mr1617 (Jap_All); LR P-value: 8.13E-08;
mr1530_2 (Jap_All); LR P-value: 2.08E-10;
mr1629_2 (Jap_All); LR P-value: 1.54E-06;
mr1693_2 (All); LR P-value: 5.50E-07
LOC_Os02g13260.1 Alt: C| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 90.483; most accessible tissue: Minghui63 flag leaf, score: 95.398
vg0207063222 (J) chr02 7063222 C T 65.50% 0.00% C -> T
mr1137 (Jap_All); LR P-value: 2.87E-11;
mr1163 (Jap_All); LR P-value: 4.50E-07;
mr1229 (All); LR P-value: 3.86E-07;
mr1229 (Jap_All); LR P-value: 3.49E-07;
mr1486 (Jap_All); LR P-value: 7.59E-11;
mr1617 (Jap_All); LR P-value: 1.08E-09;
mr1010_2 (Jap_All); LR P-value: 8.60E-08;
mr1063_2 (Jap_All); LR P-value: 4.11E-07;
mr1137_2 (Jap_All); LR P-value: 7.33E-09;
mr1161_2 (Jap_All); LR P-value: 5.25E-08;
mr1206_2 (Jap_All); LR P-value: 3.36E-06;
mr1229_2 (Jap_All); LR P-value: 3.17E-08;
mr1617_2 (Jap_All); LR P-value: 1.09E-06;
mr1865_2 (Jap_All); LR P-value: 2.21E-06;
mr1880_2 (Jap_All); LR P-value: 2.47E-08
LOC_Os02g13260.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 91.737; most accessible tissue: Minghui63 flag leaf, score: 96.143
vg0207063235 (J) chr02 7063235 G T 87.70% 0.00% T -> G
mr1137 (All); LMM P-value: 1.39E-06; LR P-value: 3.54E-34;
mr1137 (Jap_All); LR P-value: 1.02E-11;
mr1486 (Jap_All); LR P-value: 4.43E-10;
mr1617 (All); LR P-value: 9.34E-26;
mr1617 (Jap_All); LR P-value: 2.12E-08;
mr1137_2 (Jap_All); LR P-value: 2.82E-08;
mr1530_2 (Jap_All); LR P-value: 3.18E-10;
mr1617_2 (Jap_All); LR P-value: 5.21E-06;
mr1629_2 (Jap_All); LR P-value: 1.23E-06;
mr1693_2 (All); LR P-value: 7.30E-07
LOC_Os02g13260.1 Alt: G| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 91.511; most accessible tissue: Minghui63 flag leaf, score: 95.922
vg0207063322 (J) chr02 7063322 C T 99.60% 0.00% C -> T NA
LOC_Os02g13260.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 90.444; most accessible tissue: Minghui63 flag leaf, score: 94.759
vg0207063484 (J) chr02 7063484 A C 97.00% 0.08% A -> C NA
LOC_Os02g13260.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os02g13260.1 Alt: C| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 87.145; most accessible tissue: Minghui63 flag leaf, score: 94.147
vg0207063677 (J) chr02 7063677 AAGCAGC AGCAGCA GC AAGCAGC AGCAGCA GCAGC 62.50% 0.00% AAGCAGCAGC AGCAGC -> AAGCAGCAGC AGCAGCAGC, A,AAGCAGCA GCAGCAGCAG CAGC,AAGCA GCAGC NA
LOC_Os02g13260.1 Alt: AAGCAGCAGCAGCAGCAGC| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os02g13260.1 Alt: AAGCAGCAGCAGCAGCAGCAGC| disruptive_inframe_insertion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os02g13260.1 Alt: AAGCAGCAGC| disruptive_inframe_deletion MODERATE(snpEff)/inframe_variant(CooVar)
LOC_Os02g13260.1 Alt: A| disruptive_inframe_deletion MODERATE(snpEff)/inframe_variant(CooVar)
The average chromatin accessibility score: 84.844; most accessible tissue: Zhenshan97 flower, score: 92.936
vg0207063836 (J) chr02 7063836 C G 91.40% 0.00% C -> G
mr1045 (Ind_All); LR P-value: 2.48E-06;
mr1169 (Ind_All); LR P-value: 6.85E-06;
mr1195 (Ind_All); LR P-value: 4.52E-07;
mr1482 (Ind_All); LR P-value: 4.11E-06;
mr1570 (All); LR P-value: 1.32E-09;
mr1614 (Ind_All); LR P-value: 2.78E-06;
mr1951 (Ind_All); LR P-value: 8.66E-08;
mr1612_2 (All); LR P-value: 1.24E-08
LOC_Os02g13260.1 Alt: G| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
The average chromatin accessibility score: 80.567; most accessible tissue: Zhenshan97 flag leaf, score: 91.771
vg0207063931 (J) chr02 7063931 C T 65.30% 0.00% C -> T NA
LOC_Os02g13260.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 83.624; most accessible tissue: Zhenshan97 flag leaf, score: 92.587
vg0207064109 (J) chr02 7064109 G A 99.80% 0.00% G -> A NA
LOC_Os02g13260.1 Alt: A| missense_variant MODERATE(snpEff)
LOC_Os02g13250.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)
LOC_Os02g13270.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)
The average chromatin accessibility score: 80.074; most accessible tissue: Zhenshan97 flag leaf, score: 90.631
vg0207064148 (J) chr02 7064148 C T 87.70% 0.00% T -> C
mr1137 (All); LMM P-value: 3.09E-06; LR P-value: 2.73E-33;
mr1137 (Jap_All); LR P-value: 2.28E-11;
mr1486 (Jap_All); LR P-value: 4.20E-10;
mr1617 (All); LR P-value: 6.33E-26;
mr1617 (Jap_All); LR P-value: 1.17E-08;
mr1137_2 (Jap_All); LR P-value: 6.06E-08;
mr1617_2 (Jap_All); LR P-value: 5.16E-06;
mr1629_2 (Jap_All); LR P-value: 8.72E-07;
mr1693_2 (All); LR P-value: 7.68E-07
LOC_Os02g13260.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
The average chromatin accessibility score: 79.918; most accessible tissue: Zhenshan97 flag leaf, score: 89.353
vg0207064216 (J) chr02 7064216 G C 52.90% 0.00% C -> G NA
LOC_Os02g13260.1 Alt: G| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 83.245; most accessible tissue: Zhenshan97 root, score: 89.905
vg0207064223 (J) chr02 7064223 T G 52.90% 0.00% G -> T NA
LOC_Os02g13260.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
The average chromatin accessibility score: 83.421; most accessible tissue: Zhenshan97 root, score: 89.964
vg0207064226 (J) chr02 7064226 T G 52.90% 0.00% G -> T NA
LOC_Os02g13260.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
The average chromatin accessibility score: 83.381; most accessible tissue: Zhenshan97 root, score: 89.964
vg0207064236 (J) chr02 7064236 A T 91.30% 0.00% A -> T
mr1570 (All); LR P-value: 1.04E-10;
mr1126_2 (All); LR P-value: 2.33E-07;
mr1612_2 (All); LR P-value: 4.91E-10
LOC_Os02g13260.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/possibly damaging(PolyPhen-2)
The average chromatin accessibility score: 82.573; most accessible tissue: Zhenshan97 root, score: 89.844
vg0207064257 (J) chr02 7064257 G C 99.70% 0.00% G -> C NA
LOC_Os02g13260.1 Alt: C| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)
The average chromatin accessibility score: 81.571; most accessible tissue: Minghui63 flag leaf, score: 88.798
vg0207064268 (J) chr02 7064268 TA TAA 53.80% 0.00% TAA -> TA,T NA
LOC_Os02g13260.1 Alt: TA| 3_prime_UTR_variant MODIFIER(snpEff)/frameshift_variant(CooVar)
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/frameshift_variant(CooVar)
The average chromatin accessibility score: 81.223; most accessible tissue: Minghui63 flag leaf, score: 88.798
vg0207064312 (J) chr02 7064312 T G 91.20% 0.00% T -> G
mr1570 (All); LR P-value: 2.92E-10;
mr1629 (Ind_All); LR P-value: 2.23E-06;
mr1126_2 (All); LR P-value: 1.51E-06;
mr1612_2 (All); LR P-value: 4.04E-10
LOC_Os02g13260.1 Alt: G| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 77.214; most accessible tissue: Zhenshan97 root, score: 86.891
vg0207064337 (J) chr02 7064337 G A 68.60% 0.00% G -> A NA
LOC_Os02g13260.1 Alt: A| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 73.311; most accessible tissue: Zhenshan97 root, score: 86.362
vg0207064340 (J) chr02 7064340 C T 65.20% 0.02% C -> T
mr1137 (Jap_All); LR P-value: 2.87E-11;
mr1163 (Jap_All); LR P-value: 4.50E-07;
mr1229 (All); LR P-value: 1.20E-06;
mr1229 (Jap_All); LR P-value: 3.49E-07;
mr1486 (Jap_All); LR P-value: 7.59E-11;
mr1617 (Jap_All); LR P-value: 1.08E-09;
mr1010_2 (Jap_All); LR P-value: 8.60E-08;
mr1063_2 (Jap_All); LR P-value: 4.11E-07;
mr1137_2 (Jap_All); LR P-value: 7.33E-09;
mr1161_2 (Jap_All); LR P-value: 5.25E-08;
mr1206_2 (Jap_All); LR P-value: 3.36E-06;
mr1229_2 (Jap_All); LR P-value: 3.17E-08;
mr1617_2 (Jap_All); LR P-value: 1.09E-06;
mr1865_2 (Jap_All); LR P-value: 2.21E-06;
mr1880_2 (Jap_All); LR P-value: 2.47E-08
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar)
The average chromatin accessibility score: 72.937; most accessible tissue: Zhenshan97 root, score: 86.252
vg0207064341 (J) chr02 7064341 C T 92.00% 0.00% C -> T
mr1532 (All); LR P-value: 2.61E-07;
mr1532 (Ind_All); LR P-value: 2.53E-06;
mr1060_2 (All); LR P-value: 8.03E-06;
mr1400_2 (All); LR P-value: 8.22E-06
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 72.918; most accessible tissue: Zhenshan97 root, score: 86.252
vg0207064342 (J) chr02 7064342 C T 92.00% 0.00% C -> T
mr1532 (All); LR P-value: 2.61E-07;
mr1532 (Ind_All); LR P-value: 2.53E-06;
mr1060_2 (All); LR P-value: 8.03E-06;
mr1400_2 (All); LR P-value: 8.22E-06
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 72.694; most accessible tissue: Zhenshan97 root, score: 86.252
vg0207064347 (J) chr02 7064347 G A 60.50% 0.00% G -> A NA
LOC_Os02g13260.1 Alt: A| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 72.916; most accessible tissue: Zhenshan97 root, score: 86.362
vg0207064356 (J) chr02 7064356 C T 65.10% 0.00% C -> T
mr1137 (Jap_All); LR P-value: 2.87E-11;
mr1163 (Jap_All); LR P-value: 4.50E-07;
mr1229 (All); LR P-value: 1.54E-06;
mr1229 (Jap_All); LR P-value: 3.49E-07;
mr1486 (Jap_All); LR P-value: 7.59E-11;
mr1617 (Jap_All); LR P-value: 1.08E-09;
mr1010_2 (Jap_All); LR P-value: 8.60E-08;
mr1063_2 (Jap_All); LR P-value: 4.11E-07;
mr1137_2 (Jap_All); LR P-value: 7.33E-09;
mr1161_2 (Jap_All); LR P-value: 5.25E-08;
mr1206_2 (Jap_All); LR P-value: 3.36E-06;
mr1229_2 (Jap_All); LR P-value: 3.17E-08;
mr1617_2 (Jap_All); LR P-value: 1.09E-06;
mr1865_2 (Jap_All); LR P-value: 2.21E-06;
mr1880_2 (Jap_All); LR P-value: 2.47E-08
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 73.167; most accessible tissue: Zhenshan97 root, score: 86.362
vg0207064357 (J) chr02 7064357 C T 91.20% 0.00% C -> T
mr1570 (All); LR P-value: 9.88E-11;
mr1126_2 (All); LR P-value: 3.77E-07;
mr1612_2 (All); LR P-value: 5.52E-10
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 72.497; most accessible tissue: Zhenshan97 root, score: 86.026
vg0207064363 (J) chr02 7064363 C T 99.70% 0.00% C -> T NA
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)
The average chromatin accessibility score: 73.725; most accessible tissue: Zhenshan97 root, score: 87.090
vg0207064379 (J) chr02 7064379 A G 52.80% 0.02% G -> A NA
LOC_Os02g13260.1 Alt: A| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar)
The average chromatin accessibility score: 73.313; most accessible tissue: Zhenshan97 root, score: 86.991
vg0207064383 (J) chr02 7064383 A C 52.80% 0.00% C -> A NA
LOC_Os02g13260.1 Alt: A| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 73.150; most accessible tissue: Zhenshan97 root, score: 86.991
vg0207064386 (J) chr02 7064386 G A 52.90% 0.06% A -> G NA
LOC_Os02g13260.1 Alt: G| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar)
The average chromatin accessibility score: 72.876; most accessible tissue: Zhenshan97 root, score: 86.991
vg0207064391 (J) chr02 7064391 T C 52.90% 0.08% C -> T NA
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
N Alt: DEL/silent_mutation(CooVar)
The average chromatin accessibility score: 71.918; most accessible tissue: Zhenshan97 root, score: 86.579
vg0207064415 (J) chr02 7064415 G T 91.20% 0.00% G -> T
mr1570 (All); LR P-value: 9.88E-11;
mr1126_2 (All); LR P-value: 3.77E-07;
mr1612_2 (All); LR P-value: 5.52E-10
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 70.753; most accessible tissue: Zhenshan97 root, score: 85.432
vg0207064421 (J) chr02 7064421 C T 91.20% 0.00% C -> T
mr1570 (All); LR P-value: 9.88E-11;
mr1126_2 (All); LR P-value: 3.77E-07;
mr1612_2 (All); LR P-value: 5.52E-10
LOC_Os02g13260.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13250.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os02g13270.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 71.163; most accessible tissue: Zhenshan97 root, score: 85.556