Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207063222:

Variant ID: vg0207063222 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7063222
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCCCAGTAGCATGAGTCTTAACCTTGACTGGATCGCTGCCGTCCCGGCGAAGGAGGATGTCAGCGGCGCGGCGGCGGTGGAGCTGGAGAAGCTCAGGG[C/T]
GATCGCGGAGGCTGCGGCGGACAGGGCCGAGATGCACGACATCATCGGGAGGCAGCGGGACAACTGGAACCACCTGCTGCTCCACTCCAACAACTCCCTC

Reverse complement sequence

GAGGGAGTTGTTGGAGTGGAGCAGCAGGTGGTTCCAGTTGTCCCGCTGCCTCCCGATGATGTCGTGCATCTCGGCCCTGTCCGCCGCAGCCTCCGCGATC[G/A]
CCCTGAGCTTCTCCAGCTCCACCGCCGCCGCGCCGCTGACATCCTCCTTCGCCGGGACGGCAGCGATCCAGTCAAGGTTAAGACTCATGCTACTGGGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 33.90% 0.55% 0.00% NA
All Indica  2759 76.00% 23.70% 0.29% 0.00% NA
All Japonica  1512 39.80% 59.20% 0.99% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 71.80% 28.10% 0.17% 0.00% NA
Indica II  465 87.30% 12.30% 0.43% 0.00% NA
Indica III  913 73.80% 25.80% 0.33% 0.00% NA
Indica Intermediate  786 75.20% 24.60% 0.25% 0.00% NA
Temperate Japonica  767 68.40% 30.00% 1.56% 0.00% NA
Tropical Japonica  504 6.70% 92.70% 0.60% 0.00% NA
Japonica Intermediate  241 17.80% 82.20% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207063222 C -> T LOC_Os02g13260.1 missense_variant ; p.Ala87Val; MODERATE nonsynonymous_codon ; A87V Average:91.737; most accessible tissue: Minghui63 flag leaf, score: 96.143 unknown unknown DELETERIOUS 0.02

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0207063222 C T -0.02 -0.01 -0.02 -0.03 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207063222 NA 2.87E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 4.50E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 3.86E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 3.49E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 7.59E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 1.08E-09 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 8.60E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 4.11E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 7.33E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 5.25E-08 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 3.36E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 3.17E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 1.09E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 2.21E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063222 NA 2.47E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251