Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207063836:

Variant ID: vg0207063836 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7063836
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCAGCCGCCGCCGCGGCGCACGCGGCAACGGCTGGACGCCGGAGCTGGAGGAGGAGATGCGCGGCATCCTCCGCGTCATCAAGGCCAAGGACGAGCAC[C/G]
AGTACATCACGGTCGGCAAGATGGTCCTCGGCCTCAACAAGGGCCTCGCCGTGGCGGGGCCAGCGCTCGCCGGCACGGCCGCGGTGGCCGCGGCCTTCAT

Reverse complement sequence

ATGAAGGCCGCGGCCACCGCGGCCGTGCCGGCGAGCGCTGGCCCCGCCACGGCGAGGCCCTTGTTGAGGCCGAGGACCATCTTGCCGACCGTGATGTACT[G/C]
GTGCTCGTCCTTGGCCTTGATGACGCGGAGGATGCCGCGCATCTCCTCCTCCAGCTCCGGCGTCCAGCCGTTGCCGCGTGCGCCGCGGCGGCGGCTGCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.40% 8.60% 0.04% 0.00% NA
All Indica  2759 94.50% 5.50% 0.04% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 34.60% 65.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 86.90% 13.10% 0.00% 0.00% NA
Indica III  913 97.00% 3.00% 0.00% 0.00% NA
Indica Intermediate  786 91.70% 8.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 60.40% 1.04% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207063836 C -> G LOC_Os02g13260.1 missense_variant ; p.Gln292Glu; MODERATE nonsynonymous_codon ; Q292E Average:80.567; most accessible tissue: Zhenshan97 flag leaf, score: 91.771 benign -0.348 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0207063836 C G 0.0 -0.01 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207063836 NA 2.48E-06 mr1045 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063836 NA 6.85E-06 mr1169 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063836 NA 4.52E-07 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063836 NA 4.11E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063836 NA 1.32E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063836 NA 2.78E-06 mr1614 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063836 NA 8.66E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207063836 NA 1.24E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251