Variant ID: vg1107619278 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 7619278 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGTGTAAATATAAAAAAAAAATTAAGTCACGCTTAAAAAGTCACAATAAAATAAATAAGTTTAAATAAGATGAATGATTAAACGTATAAAAAATCAAGGG[T/C]
GTTGTATATTAAAAAAAAGAGGTATATGTTTAAGGACTACAAGCCAATACTACTGCTAATCAATAGTGTCTAATGTTGGATTTATTCACTAACATGTTCT
AGAACATGTTAGTGAATAAATCCAACATTAGACACTATTGATTAGCAGTAGTATTGGCTTGTAGTCCTTAAACATATACCTCTTTTTTTTAATATACAAC[A/G]
CCCTTGATTTTTTATACGTTTAATCATTCATCTTATTTAAACTTATTTATTTTATTGTGACTTTTTAAGCGTGACTTAATTTTTTTTTTATATTTACACA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 86.00% | 13.90% | 0.17% | 0.00% | NA |
All Indica | 2759 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 80.50% | 19.00% | 0.53% | 0.00% | NA |
Aus | 269 | 19.30% | 80.70% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 69.10% | 30.10% | 0.78% | 0.00% | NA |
Tropical Japonica | 504 | 93.70% | 6.20% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 89.20% | 10.40% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1107619278 | T -> C | LOC_Os11g13830.1 | upstream_gene_variant ; 721.0bp to feature; MODIFIER | silent_mutation | Average:65.023; most accessible tissue: Callus, score: 95.888 | N | N | N | N |
vg1107619278 | T -> C | LOC_Os11g13820.1 | downstream_gene_variant ; 543.0bp to feature; MODIFIER | silent_mutation | Average:65.023; most accessible tissue: Callus, score: 95.888 | N | N | N | N |
vg1107619278 | T -> C | LOC_Os11g13820-LOC_Os11g13830 | intergenic_region ; MODIFIER | silent_mutation | Average:65.023; most accessible tissue: Callus, score: 95.888 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1107619278 | NA | 1.04E-16 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg1107619278 | NA | 4.15E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107619278 | NA | 4.82E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107619278 | NA | 1.88E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107619278 | NA | 8.51E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107619278 | NA | 2.83E-06 | mr1372 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107619278 | NA | 3.89E-07 | mr1432 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |