Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0824221287:

Variant ID: vg0824221287 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 24221287
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAGCTGATGAAATGCAAGGGTCACCCTGCTTACGACGTCAATCCACTTCCTTCCCATGAGGCCATGACATCAACCGGGGCAATCCATTACTTCCTCCGT[C/T]
TCAGAATATAATTATTTTTAAAATTAAATATAGTTATTAAAAAAATAGGTAGAATTAAATAATGTATGGTTGTGATTAGATGATAAGTGAAGATAGGTAA

Reverse complement sequence

TTACCTATCTTCACTTATCATCTAATCACAACCATACATTATTTAATTCTACCTATTTTTTTAATAACTATATTTAATTTTAAAAATAATTATATTCTGA[G/A]
ACGGAGGAAGTAATGGATTGCCCCGGTTGATGTCATGGCCTCATGGGAAGGAAGTGGATTGACGTCGTAAGCAGGGTGACCCTTGCATTTCATCAGCTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.80%	18.10%	0.11%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.00%	0.00%	NA
All Japonica	1512	57.40%	42.30%	0.33%	0.00%	NA
Aus	269	73.20%	26.80%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	98.40%	1.60%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	3.30%	0.00%	0.00%	NA
Temperate Japonica	767	60.20%	39.50%	0.26%	0.00%	NA
Tropical Japonica	504	60.70%	38.90%	0.40%	0.00%	NA
Japonica Intermediate	241	41.50%	58.10%	0.41%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0824221287	C -> T	LOC_Os08g38210.1	upstream_gene_variant ; 1119.0bp to feature; MODIFIER	silent_mutation	Average:91.749; most accessible tissue: Minghui63 panicle, score: 97.934	N	N	N	N
vg0824221287	C -> T	LOC_Os08g38210.2	upstream_gene_variant ; 2015.0bp to feature; MODIFIER	silent_mutation	Average:91.749; most accessible tissue: Minghui63 panicle, score: 97.934	N	N	N	N
vg0824221287	C -> T	LOC_Os08g38210.4	upstream_gene_variant ; 4406.0bp to feature; MODIFIER	silent_mutation	Average:91.749; most accessible tissue: Minghui63 panicle, score: 97.934	N	N	N	N
vg0824221287	C -> T	LOC_Os08g38210.5	upstream_gene_variant ; 4786.0bp to feature; MODIFIER	silent_mutation	Average:91.749; most accessible tissue: Minghui63 panicle, score: 97.934	N	N	N	N
vg0824221287	C -> T	LOC_Os08g38200-LOC_Os08g38210	intergenic_region ; MODIFIER	silent_mutation	Average:91.749; most accessible tissue: Minghui63 panicle, score: 97.934	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0824221287	C	T	-0.05	-0.05	-0.03	-0.04	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0824221287	8.69E-06	2.68E-17	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0824221287	NA	5.10E-09	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824221287	NA	2.25E-14	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0824221287	NA	1.77E-08	mr1915_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251