Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703940621:

Variant ID: vg0703940621 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 3940621
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTATAAATTATTGTCACACAACGAAGTGTGTTATTTATTAGCCATTGAAAATTGCATATTCATCAAGGAAGTATGAAATTGCATATAGCTATTTAAAA[G/C]
CTATTGGTTTACTTGTAGTAAACAATATCCTAAATAATTAATGACCTTTTGGATTCAATTGATTCTGAATGATCAAATGACACCACATTTACTTTGGCGT

Reverse complement sequence

ACGCCAAAGTAAATGTGGTGTCATTTGATCATTCAGAATCAATTGAATCCAAAAGGTCATTAATTATTTAGGATATTGTTTACTACAAGTAAACCAATAG[C/G]
TTTTAAATAGCTATATGCAATTTCATACTTCCTTGATGAATATGCAATTTTCAATGGCTAATAAATAACACACTTCGTTGTGTGACAATAATTTATAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.00%	4.20%	7.93%	67.94%	NA
All Indica	2759	12.10%	0.70%	9.82%	77.38%	NA
All Japonica	1512	36.70%	6.00%	3.04%	54.23%	NA
Aus	269	9.30%	1.50%	17.47%	71.75%	NA
Indica I	595	9.70%	0.00%	5.71%	84.54%	NA
Indica II	465	14.20%	0.00%	8.39%	77.42%	NA
Indica III	913	11.50%	0.10%	12.60%	75.79%	NA
Indica Intermediate	786	13.40%	2.30%	10.56%	73.79%	NA
Temperate Japonica	767	56.70%	9.50%	3.39%	30.38%	NA
Tropical Japonica	504	9.70%	0.80%	2.58%	86.90%	NA
Japonica Intermediate	241	29.50%	5.80%	2.90%	61.83%	NA
VI/Aromatic	96	0.00%	79.20%	4.17%	16.67%	NA
Intermediate	90	32.20%	7.80%	7.78%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0703940621	G -> DEL	N	N	silent_mutation	Average:5.66; most accessible tissue: Callus, score: 17.595	N	N	N	N
vg0703940621	G -> C	LOC_Os07g07840.1	upstream_gene_variant ; 3761.0bp to feature; MODIFIER	silent_mutation	Average:5.66; most accessible tissue: Callus, score: 17.595	N	N	N	N
vg0703940621	G -> C	LOC_Os07g07850.1	upstream_gene_variant ; 2403.0bp to feature; MODIFIER	silent_mutation	Average:5.66; most accessible tissue: Callus, score: 17.595	N	N	N	N
vg0703940621	G -> C	LOC_Os07g07850-LOC_Os07g07860	intergenic_region ; MODIFIER	silent_mutation	Average:5.66; most accessible tissue: Callus, score: 17.595	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0703940621	NA	2.42E-17	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0703940621	4.11E-06	4.16E-07	mr1382	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621	NA	3.17E-07	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621	NA	1.02E-06	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621	NA	1.83E-10	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621	NA	3.19E-07	mr1465_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621	NA	2.68E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251