Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701269751:

Variant ID: vg0701269751 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1269751
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAAATCTACGGACTTCCCTCTTGACGGAAATCTGAATCTGCACAAACTCGCCCATTAGAGGAAATCTGAATCTGCACAAACTCGCCCATTAGTAAAAA[C/T]
ATTTGTATTGACGGCTTGCAATGTTAAATCTCCTACCAACTATGTAAAATTACAATTTTGTAAGTTAAATCAAGTTTCGAAGAGAATTGAATGAAATTCG

Reverse complement sequence

CGAATTTCATTCAATTCTCTTCGAAACTTGATTTAACTTACAAAATTGTAATTTTACATAGTTGGTAGGAGATTTAACATTGCAAGCCGTCAATACAAAT[G/A]
TTTTTACTAATGGGCGAGTTTGTGCAGATTCAGATTTCCTCTAATGGGCGAGTTTGTGCAGATTCAGATTTCCGTCAAGAGGGAAGTCCGTAGATTTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.10%	9.90%	0.00%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.00%	0.00%	NA
All Japonica	1512	80.40%	19.60%	0.00%	0.00%	NA
Aus	269	81.40%	18.60%	0.00%	0.00%	NA
Indica I	595	97.10%	2.90%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	99.00%	1.00%	0.00%	0.00%	NA
Temperate Japonica	767	68.60%	31.40%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	5.40%	0.00%	0.00%	NA
Japonica Intermediate	241	88.40%	11.60%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	86.70%	13.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701269751	C -> T	LOC_Os07g03210.1	upstream_gene_variant ; 4301.0bp to feature; MODIFIER	silent_mutation	Average:66.067; most accessible tissue: Callus, score: 88.15	N	N	N	N
vg0701269751	C -> T	LOC_Os07g03230.1	upstream_gene_variant ; 4804.0bp to feature; MODIFIER	silent_mutation	Average:66.067; most accessible tissue: Callus, score: 88.15	N	N	N	N
vg0701269751	C -> T	LOC_Os07g03230.2	upstream_gene_variant ; 4804.0bp to feature; MODIFIER	silent_mutation	Average:66.067; most accessible tissue: Callus, score: 88.15	N	N	N	N
vg0701269751	C -> T	LOC_Os07g03220.1	downstream_gene_variant ; 1201.0bp to feature; MODIFIER	silent_mutation	Average:66.067; most accessible tissue: Callus, score: 88.15	N	N	N	N
vg0701269751	C -> T	LOC_Os07g03220-LOC_Os07g03230	intergenic_region ; MODIFIER	silent_mutation	Average:66.067; most accessible tissue: Callus, score: 88.15	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701269751	1.77E-08	1.01E-31	Awn_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0701269751	NA	1.88E-10	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0701269751	3.12E-06	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701269751	NA	6.30E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701269751	NA	1.76E-06	mr1707	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701269751	NA	2.41E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701269751	5.19E-06	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701269751	NA	6.76E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251