Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608836602:

Variant ID: vg0608836602 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8836602
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGACATGACATCTCATCACACAAGCTAGTACTCTCTCTGTTTCACCGTTTCAGATTATAAGTCGTTTTGACTTTGATCAAAATCAAACTATTTTAAATTT[A/G]
ATTAAGTTTGTAGAAAAAAAACTGTAATATTTTTAACCCAAAATAAATATATTAAGAAAATATACTTAATTATTGATCTAATAAAACTAATTTGGTTTTA

Reverse complement sequence

TAAAACCAAATTAGTTTTATTAGATCAATAATTAAGTATATTTTCTTAATATATTTATTTTGGGTTAAAAATATTACAGTTTTTTTTCTACAAACTTAAT[T/C]
AAATTTAAAATAGTTTGATTTTGATCAAAGTCAAAACGACTTATAATCTGAAACGGTGAAACAGAGAGAGTACTAGCTTGTGTGATGAGATGTCATGTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	6.70%	3.51%	0.00%	NA
All Indica	2759	99.30%	0.40%	0.33%	0.00%	NA
All Japonica	1512	85.50%	4.20%	10.25%	0.00%	NA
Aus	269	14.10%	85.90%	0.00%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	99.40%	0.00%	0.65%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.40%	0.38%	0.00%	NA
Temperate Japonica	767	73.00%	6.90%	20.08%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.10%	0.41%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608836602	A -> G	LOC_Os06g15570.1	upstream_gene_variant ; 4647.0bp to feature; MODIFIER	silent_mutation	Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0608836602	A -> G	LOC_Os06g15590.1	upstream_gene_variant ; 973.0bp to feature; MODIFIER	silent_mutation	Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0608836602	A -> G	LOC_Os06g15570.2	upstream_gene_variant ; 4291.0bp to feature; MODIFIER	silent_mutation	Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0608836602	A -> G	LOC_Os06g15580.1	downstream_gene_variant ; 2216.0bp to feature; MODIFIER	silent_mutation	Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0608836602	A -> G	LOC_Os06g15600.1	downstream_gene_variant ; 355.0bp to feature; MODIFIER	silent_mutation	Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N
vg0608836602	A -> G	LOC_Os06g15590-LOC_Os06g15600	intergenic_region ; MODIFIER	silent_mutation	Average:37.766; most accessible tissue: Zhenshan97 panicle, score: 57.341	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608836602	3.99E-11	NA	Awn_length	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0608836602	2.95E-06	3.87E-09	Awn_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0608836602	NA	1.27E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602	NA	2.45E-41	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602	NA	4.81E-39	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602	NA	2.88E-37	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602	NA	4.89E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602	NA	3.73E-31	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608836602	NA	1.30E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251